Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

RPA primer, probe, kit and method for detecting enterocytozoon hepatopenaei

A technology of Enteroplasma hepatica and kit, applied in biochemical equipment and methods, DNA/RNA fragments, recombinant DNA technology, etc., can solve the problems of high false positive of LAMP, inability to quantify Enteroplasma hepatica, difficulty in primer design, etc. Achieve the effects of good detection repeatability, suitable for popularization and use, and improve specificity and sensitivity

Active Publication Date: 2021-09-24
SUN YAT SEN UNIV
View PDF5 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In the actual detection process, in situ hybridization and ELISA are time-consuming and low in sensitivity; although colloidal gold test strips are fast in detection, but low in sensitivity; LAMP has high false positives; although PCR detection methods have a high Specificity and sensitivity, but the dependence on precision instruments—PCR machines limits its widespread use
[0005] Recombinase polymerase amplification (RPA) has the advantages of convenient operation, fast detection speed and high sensitivity, but the method is difficult to design primers and method construction, so it is rarely used in the detection of aquatic pathogens
Chinese patent CN111979342A discloses a specific primer pair, a detection kit and its application for rapid detection of E. hepatica using RPA-LFS. cover, which can easily cause contamination, which can lead to false positive results

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • RPA primer, probe, kit and method for detecting enterocytozoon hepatopenaei
  • RPA primer, probe, kit and method for detecting enterocytozoon hepatopenaei
  • RPA primer, probe, kit and method for detecting enterocytozoon hepatopenaei

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] Example 1 Construction and optimization of Real-time RPA reaction system

[0038] The present invention takes enteroplasma hepatica (EHP) cell wall protein SWP gene (spore wall protein gene) as the target gene, and the accession number of the target gene is KX258197.1.

[0039]1. Firstly, according to the gene sequence of the Enterocystis hepatopenaei (EHP) in Environmental Samples in Shrimp published in GeneBank, references (JaroenlakP, Sanguanrut P, ​​Williams B, et al. 2 pairs of PCR amplification primers in Farms[J].Plos One,2016,11(11):e0166320.) were used to amplify and sequence the gene of SWP by PCR. The primers were synthesized by Sangon Bioengineering Co., Ltd.

[0040] The sequences of the 2 pairs of PCR amplification primers are as follows:

[0041] swp-514-F: TTGCAGAGTGTTGTTAAGGGTTT

[0042] swp-514-R: CACGATGTGTCTTTGCAATTTTC

[0043] swp-148-F: TTGGCGGCACAATTCTCAAACA

[0044] swp-148-R: GCTGTTTGTCTCCAACTGTATTTGA

[0045] 2. Genomic DNA extraction

...

Embodiment 2

[0069] Embodiment 2 specificity test

[0070] In order to detect the specificity of the Real-time RPA detection method, the present invention selects several common shrimp pathogenic genomic DNAs, including white spot syndrome virus (White Spot Syndrome Virus, WSSV), taura disease virus (TauraSyndrome Virus, TSV), infection Infectious Hypodermal and Hematopoietic Necrosis Virus (IHHNV), Decapod iridescent virus 1 (DIV1) and Acute Hepatopancreatic Necrosis Disease (AHPND).

[0071] The DNA of various genomes was diluted to 10 ng / μL, and the reaction system and temperature were the same as in Example 1 to verify the specificity of the optimized Real-time RPA detection method. Specific test results such as image 3 As shown, the results showed that except for the positive amplification curve of EHP, no amplification curve appeared for other pathogens, and no amplification curve appeared for the water-added control group, indicating that the constructed Real-time RPA detection me...

Embodiment 3

[0072] Embodiment 3 sensitivity test

[0073] The positive control plasmid constructed in Example 1 was used ddH 2 O was diluted sequentially, and the dilution concentration was 10 8 copies / μL, 10 7 copies / μL, 10 6 copies / μL, 10 5 copies / μL, 10 4 copies / μL, 10 3 copies / μL, 10 2 copies / μL, 10 1 copies / μL, 10 0 copies / μL total of 9 concentration gradients. Take 0.8 μL template DNA of different concentrations for Real-time RPA and Nested PCR detection respectively, test the sensitivity difference by different methods, and use ddH 2 O is the control. The reaction system and reaction conditions of Real-time RPA are the same as in Example 1.

[0074] The present invention quotes the primer sequences reported in the literature as the control of the constructed Real-time RPA method. The amplification primers of Nest PCR are respectively swp-514-F / R and swp-148-F / R, and the specific sequences are referred to in Example 1, wherein swp-514-F / R is an amplification primer, and ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an RPA primer, a probe, a kit and a method for detecting enterocytozoon hepatopenaei. A pair of RPA primers and probes with high specificity is designed and screened by taking the cell wall protein gene of the enterocytozoon hepatopenaei as a target gene, and a Real-time RPA method for detecting EHP is established on the basis of the RPA primers and the probes. The method is simple in operation, is high in detection sensitivity, is capable of detecting plasmid DNA molecules of 10 copies / mu L at least, has good repeatability, and has a reliable detection result. The method is suitable for detection and identification of EHP pathogens in litopenaeus vannamei culture, and is an attempt of applying Real-time RPA to quantitative detection of EHP for the first time.

Description

technical field [0001] The invention belongs to the technical field of aquatic pathogen detection. More specifically, it relates to an RPA primer, probe, kit and method for detecting Enterocystis hepatica. Background technique [0002] Since my country introduced Litopenaeus vannamei from the Hawaiian Islands in 1988, artificially propagated successfully in 1992, and started mass seedling production in 2000, with the expansion of breeding scale year by year, Litopenaeus vannamei has become the pillar of my country's aquaculture industry. Variety. In recent years, my country has become the largest farming country of Litopenaeus vannamei in the world, and my country's shrimp farming industry plays a leading role in the development of shrimp farming in the world. However, diseases have limited the development of the prawn farming industry. Viruses, bacteria, fungi, rickettsia, parasites, etc. can all cause prawn disease. Viral pathogens in shrimp farming mainly include White ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6888C12Q1/6844C12N15/11
CPCC12Q1/6888C12Q1/6844C12Q2521/507C12Q2521/101C12Q2563/107C12Q2561/113Y02A50/30Y02A40/81
Inventor 何建国庞建虎翁少萍
Owner SUN YAT SEN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com