Nested primer used for early warning of enterocytozoon hepatopenaei of Chinese cultured shrimps and application of nested primer

Abstract

The invention relates to a nested primer used for early warning of enterocytozoon hepatopenaei infection of Chinese cultured shrimps and an application of the nested primer. The nested primer comprises a pair of outer primers EMISF / EMISR and a pair of inner primers EMISnF / EMISnR, wherein the specific sequences are as follows: EMISF: GCGGTAATTCCAACTCCAAG; EMISR: TAAGCAGCACAATCCACTCC; EMISnF: AGTAGCGGAACGGATAGGGA; EMISnR: ACCCAGCATTGTCGGCATAG. The nested primer is very high in detection flexibility and good in specificity, suitable for monitoring enterocytozoon hepatopenaei in young shrimps with extremely low content and very small tissue dose, suitable for early monitoring and early warning of trace infection or latent infection of the enterocytozoon hepatopenaei of the Chinese cultured shrimps, and has good application prospect.

Description

technical field [0001] The invention belongs to the field of disease prevention and treatment of cultured prawns, and in particular relates to a nested primer for early warning of Enterococcus hepatica infection in cultured prawns in my country and an application thereof. Background technique [0002] In recent years, follow-up studies and epidemiological investigations on the diseases of prawns in my country have found that a type of prawn microsporidia, Enterocytozoon hepatopenaei, which has only become popular in South Asia in recent years, has been cultured in my country. It is also widely popular in prawns. Pathological and other analysis showed that a large number of Shrimp Enteroplasma hepaticas in different developmental stages were detected in shrimps with symptoms (white stool syndrome) collected from various places. Infected shrimp hepatopancreatic cells are full of microsporidian spores, and the cells are severely vacuolated until disintegrated. Infected shrimps ...

AI Technical Summary

Problems solved by technology

Molecular PCR diagnostic technology is suitable for the rapid diagnosis of E. hepatica in shrimp, especially E. hepatica in seedlings and shrimp seedlings due to its rapidity, simplicity, and small amount of sample tissue required. There is no official report on E. hepatica in my country, and there is no molecular detection technology for the endemic species of E. hepatica in my country. It is urgent to design highly specific and sensitive primers for the endemic species in China to provide early warning and monitoring of E. hepatica in cultured shrimp in my country. Provide technical support for timely prevention

[0004] Because microsporidia are intracellular parasites and have a hard chitin shell, which not only affects the extraction efficiency of DNA, but also tends to produce shorter fragments, microsporidia based on general primers (amplification of long fragments) at home and abroad The detection rate of ordinary PCR for insects is much lower than that of pathogens such as bacteria and viruses. Although the sensitivity of quantitative PCR technology has been improved to a certain extent, the detection cost has been greatly increased, and the requirements for instruments are higher.

Images