Nested primer used for early warning of enterocytozoon hepatopenaei of Chinese cultured shrimps and application of nested primer

A technique for Shrimp Hepatic Enterocystis and Hepatic Enterococcus, which is applied in the field of nested primers, can solve the problems of no molecular detection technology, high requirements for instruments, and increased detection costs, and achieve good application prospects, high sensitivity, and good specificity

Active Publication Date: 2015-09-23
EAST CHINA SEA FISHERIES RES INST CHINESE ACAD OF FISHERY SCI
View PDF2 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Molecular PCR diagnostic technology is suitable for the rapid diagnosis of E. hepatica in shrimp, especially E. hepatica in seedlings and shrimp seedlings due to its rapidity, simplicity, and small amount of sample tissue required. There is no official report on E. hepatica in my country, and there is no molecular detection technology for the endemic species of E. hepatica in my country. It is urgent to design highly specific and sensitive primers for the endemic species in China to provide early warning and monitoring of E. hepatica in cultured shrimp in my country. Provide technical support for timely prevention
[0004] Because microsporidia are intracellular parasites and have a hard chitin shell, which not only affects the extraction efficiency of DNA, but also tends to produce shorter fragments, microsporidia based on general primers (amplification of long fragments) at home and abroad The detection rate of ordinary PCR for insects is much lower than that of pathogens such as bacteria and viruses. Although the sensitivity of quantitative PCR technology has been improved to a certain extent, the detection cost has been greatly increased, and the requirements for instruments are higher.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Nested primer used for early warning of enterocytozoon hepatopenaei of Chinese cultured shrimps and application of nested primer
  • Nested primer used for early warning of enterocytozoon hepatopenaei of Chinese cultured shrimps and application of nested primer
  • Nested primer used for early warning of enterocytozoon hepatopenaei of Chinese cultured shrimps and application of nested primer

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0020] EMISF / EMISR primers and nested primers (EMISF / EMISR and EMISnF / EMISnR) were used to amplify DNA templates of hepatopancreas from 4 shrimp ponds for PCR amplification.

[0021] External primer (EMISF / EMISR) amplification system and conditions: the amplification system is 25 μL in total, consisting of 1 μL tissue DNA template, 0.5 μL forward external primer EMISF (10 μM), 0.5 μL reverse external primer EMISR (10 μM), 12.5 μL Green Master Mix (promega) and 10.5 μL DNase-free water. Amplification conditions were as follows: pre-denaturation at 95°C for 4 min, followed by 25 cycles of 95°C for 40 s, 52°C for 30 s, and 72°C for 35 s, and finally extension at 72°C for 5 min. A portion of the PCR product was used as a template for internal primer amplification.

[0022] Internal primer (EMISnF / EMISnR) amplification system and conditions: Amplification system total 25 μL, PCR product amplified by 1 μL external primer, 0.4 μL forward internal primer EMISnF (10 μM), 0.4 μL rever...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to a nested primer used for early warning of enterocytozoon hepatopenaei infection of Chinese cultured shrimps and an application of the nested primer. The nested primer comprises a pair of outer primers EMISF / EMISR and a pair of inner primers EMISnF / EMISnR, wherein the specific sequences are as follows: EMISF: GCGGTAATTCCAACTCCAAG; EMISR: TAAGCAGCACAATCCACTCC; EMISnF: AGTAGCGGAACGGATAGGGA; EMISnR: ACCCAGCATTGTCGGCATAG. The nested primer is very high in detection flexibility and good in specificity, suitable for monitoring enterocytozoon hepatopenaei in young shrimps with extremely low content and very small tissue dose, suitable for early monitoring and early warning of trace infection or latent infection of the enterocytozoon hepatopenaei of the Chinese cultured shrimps, and has good application prospect.

Description

technical field [0001] The invention belongs to the field of disease prevention and treatment of cultured prawns, and in particular relates to a nested primer for early warning of Enterococcus hepatica infection in cultured prawns in my country and an application thereof. Background technique [0002] In recent years, follow-up studies and epidemiological investigations on the diseases of prawns in my country have found that a type of prawn microsporidia, Enterocytozoon hepatopenaei, which has only become popular in South Asia in recent years, has been cultured in my country. It is also widely popular in prawns. Pathological and other analysis showed that a large number of Shrimp Enteroplasma hepaticas in different developmental stages were detected in shrimps with symptoms (white stool syndrome) collected from various places. Infected shrimp hepatopancreatic cells are full of microsporidian spores, and the cells are severely vacuolated until disintegrated. Infected shrimps ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/11C12Q1/68
Inventor 周俊芳房文红周红霞王元
Owner EAST CHINA SEA FISHERIES RES INST CHINESE ACAD OF FISHERY SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products