Patents
Literature
Hiro is an intelligent assistant for R&D personnel, combined with Patent DNA, to facilitate innovative research.
Hiro

38results about How to "Cause trauma" patented technology

Method for judging antenatal parental right relation with SNP

The invention provides a method for judging antenatal parental right relation with SNP. The SNP is used as a genetic marker, and judgment of the antenatal parental right relation is conducted through cooperation of the SNP and the high throughput sequencing technology. Only 10 ml of maternal peripheral blood is needed, free DNA extracted from the maternal peripheral blood plasma contains the free DNA of a fetus already, so that only one sample of a mother and the fetus is needed. Due to the fact that only the venous blood of a pregnant woman needs to be extracted, operation is simple and convenient, the pregnant woman and the fetus cannot be damaged, and the fetus can be identified after 10 weeks of pregnancy.
Owner:厦门万基生物科技有限公司

Integrated detection method for separating, enriching and detecting urine exosome as well as detection chip

The invention provides an integrated detection method for separating, enriching and detecting an exosome. The method comprises the following steps: designing and assembling a dual-membrane filtration chip, constructing an ELISA detection standard curve, collecting a sample, injecting and washing, performing chip ELISA detection, and performing data processing analysis. The invention also provides an integrated detection chip for separating, enriching and detecting a urine exosome. A reaction system and the detection method of the present invention can be used for detecting the content of a urine sample of a bladder cancer patient and the exosome in a supernatant of a bladder cancer cell line nutrient solution. The detection chip has characteristic of high specificity, generates no influence or wound on human body, and the detection method does not require the expensive precision experiment apparatus (such as an ultra centrifuge and a fluorescence microscope), and has large application prospect.
Owner:ZHEJIANG UNIV

Calculation Method of Blood Flow Reserve Fraction

The invention provides a calculation method of blood flow reserve fraction, comprising the following steps: image acquisition: continuously acquiring a plurality of blood vessel images through a CT scanner; Establishing a first model: establishing a first model based on the plurality of blood vessel images; Determining a narrow segment: determining the narrow segment by the first model; Establishing a second model: eliminating a narrow segment of the first model; FFR calculation: that blood flow reserve fraction is calculate using the formula FFR=Pd / Pa, wherein Pd is the blood pressure of thestenosis segment in the first model and Pa is the blood pressure of the blood vessel correspond to the stenosis segment in the first model in the second model. The invention has the advantages of no need to use the medicine for dilating blood vessels in the process and no physiological trauma to the patient, and has the characteristics of safety, convenience, precision and the like.
Owner:深圳市孙逸仙心血管医院

miRNA associated with colorectal cancer and application thereof

The invention belongs to the field of nucleic acid diagnosis and treatment and specifically relates to miRNA associated with colorectal cancer and an application thereof. The miRNA associated with colorectal cancer is miR-1290. The invention provides an application of the miR-1290 used in preparing a kit for distinguishing a colorectal cancer sample and a normal sample in a blood sample of a subject. The invention confirms for the first time that the miR-1290 is a colorectal cancer-associated miRNA diagnosis marker, and a novel colorectal cancer progression detection index is established. On this basis, the invention provides a new application of the miR-1290 in initial diagnosis and rapid detection of colorectal cancer and a related universally applicable kit.
Owner:GUANGZHOU FULENGEN

Automatic quenching production line

The invention discloses an automatic quenching production line, and belongs to the field of plate spring shaping and heat treatment equipment. The automatic quenching production line is characterized by comprising a stepping type quenching furnace, a plate spring bending shaping device and a quenching pond. The stepping type quenching furnace is linked with the plate spring bending shaping device through a mechanical hand, and the plate spring bending shaping device is linked with the quenching pond through an oil inlet mechanism. The plate spring bending shaping device comprises a shaping machine frame, a feeding mechanism, a length alignment mechanism, a width alignment mechanism, a shaping device and a material supporting lifting mechanism; the feeding mechanism, the length alignment mechanism, the width alignment mechanism, the shaping device and the material supporting lifting mechanism are installed on the shaping machine frame. Heating, shaping and quenching operation of a plate spring can be automatically implemented, various working procedures are automatically and continuously executed, linage is compact, and the product production efficiency and the output quality are greatly improved.
Owner:SHANDONG LEOPARD AUTOMOTIVE HLDG

Intermediate-advanced stage cancer imaging detecting system and method based on quantum superstring engine

The invention discloses an intermediate-advanced stage cancer imaging detecting system and an intermediate-advanced stage cancer imaging detecting method based on the quantum superstring engine, mainly used for overcoming the defect that the traditional medical device can not efficiently, safely, rapidly and comprehensively detect the cancer cell spreading area of a cancer patient. The intermediate-advanced stage cancer imaging detecting system comprises a quantum light emission source, an optical splitter, a convex lens, a light filter group, a detection unit, an image processing unit and a display. The intermediate-advanced stage cancer imaging detecting method comprises the steps that orthogonal polarized photons generated by the quantum light emission source pass through the optical splitter, and then are transmitted in two paths; one path of the orthogonal polarized photons irradiates the body of the patient through the convex lens and light filters, penetrates through the body and then is received by a detector, and the other path of the orthogonal polarized photons directly passes through the light filters, and are received by another detector; the detection unit carries out combined measurement on the photons detected by the two detectors, and outputs a detection result to the image processing unit, the image processing unit draws a diffusion area imaging picture of cancer cells in the body of the patient, and the diffusion area imaging picture is displayed by the display. With the adoption of the intermediate-advanced stage cancer imaging detecting system and the intermediate-advanced stage cancer imaging detecting method, the diffusion area imaging picture of the cancer cells can be obtained, and thus a basis is provided for the treatment and research on the cancer patient.
Owner:XIAN UNIV OF POSTS & TELECOMM

Intracavitary bendable imbedding apparatus with freeze probe

A tubular inserter with freezing probe and able to be curved in cavity for the freeze therapy in seophagus cavity and bronchus cavity has a regulating valve, a connector connected to said regulating valve and with tube inlet, air exhaust outlet and electric plug, an inserted flexible tube containing a freezing tube and the electric line, and a freezing probe at the front end of said flexible tube and with a temp sensor on its inner surface.
Owner:SHANDONG TUMOR HOSPITAL

Glucose measuring device and apparatus

A glucose measuring device and apparatus are provided. The device includes a substrate, a cover plate, an electrode assembly, and a reactive unit. The substrate has first and second surfaces oppositeto each other, and a flow channel located at the first surface. The flow channel includes a sampling region having a sample inlet, a measuring region, and a concentrating region therebetween. The cover plate having a gas outlet is disposed on the first surface and covers the flow channel. The electrode assembly includes a first, a second and a third electrode pairs. The first electrode pair is ata boundary between the sampling and the concentrating regions. The second electrode pair is at a boundary between the concentrating and the measuring regions. The third electrode pair is located in the measuring region. The reactive unit is disposed on the third electrode pair and in the flow channel. The glucose measuring device and apparatus have high glucose measuring accuracy.
Owner:APEX BIOTECH

Thighbone lesser trochanter fixing device used for clinical orthopedic surgery

The invention provides a thighbone lesser trochanter fixing device used for clinical orthopedic surgery. The device comprises two handles which are connected through a hinge, wherein a first handle is arc-shaped on one side of the hinge and is linear on the other side of the hinge, the second handle is linear, an arc-shaped end of the first handle is provided with an arc-shaped cover, one end of the second handle is provided with an arc-shaped cover, the arc-shaped cover of the second handle and the arc-shaped cover of the first handle are arranged on the same side, an opening of one arc-shaped cover faces the other arc-shaped cover, a through hole is formed in each arc-shaped cover, a sleeve is installed in the through hole of the arc-shaped cover of the second handle, and one end of the first handle and one end of the second handle, away from the arc-shaped covers, are provided with limiting strips. The fixing devices can effectively fix the thighbone lesser trochanter, meanwhile can improve precision of punching of an electrical drill, and is beneficial for proceeding of an operation.
Owner:SHANDONG PROVINCIAL HOSPITAL

Cynoglossus semilaevis exosome gender difference expression label and kit

The invention relates to a cynoglossus semilaevis exosome gender difference expression label and a kit, belonging to the field of fish biotechnology. A micro ribonucleic acid (miRNA) gender label is dre-miR-10d-5p, and a sequence is TACCCTGTAGAACCGAATGTGTG; the problem of distinguishing reproductive genetic differences between male cynoglossus semilaevis and female pseudo-male cynoglossus semilaevis is solved. The marker miRNAs have the characteristic of significant difference expression of male fish and female pseudo-male fish, and are specific molecular recognition markers.
Owner:TIANJIN BOHAI SEA FISHERIES RES INST

A method for prenatal paternity determination using SNP

The invention provides a method for judging antenatal parental right relation with SNP. The SNP is used as a genetic marker, and judgment of the antenatal parental right relation is conducted through cooperation of the SNP and the high throughput sequencing technology. Only 10 ml of maternal peripheral blood is needed, free DNA extracted from the maternal peripheral blood plasma contains the free DNA of a fetus already, so that only one sample of a mother and the fetus is needed. Due to the fact that only the venous blood of a pregnant woman needs to be extracted, operation is simple and convenient, the pregnant woman and the fetus cannot be damaged, and the fetus can be identified after 10 weeks of pregnancy.
Owner:厦门万基生物科技有限公司

Glucose electrode, micro-fluidic chip, micro-fluidic passive sweat patch, and preparation method and application of micro-fluidic passive sweat patch

The invention relates to a glucose electrode, a micro-fluidic chip, a micro-fluidic passive sweat patch, and a preparation method and application of the micro-fluidic passive sweat patch. The glucose electrode comprises a substrate electrode, and a polyaniline film and a glucose oxidase film which are sequentially coated on the surface of the substrate electrode. An ion-selective glucose electrode is formed by modifying an ion-selective film on the substrate electrode, passive detection of glucose in sweat is realized by utilizing the ion-selective electrode for the first time, the principle is that glucose oxidase catalyzes glucose to generate hydrogen ions, and then the hydrogen ion-selective electrode is used for detecting the generated hydrogen ions, furthermore, the glucose concentration is calculated, and no trauma is caused to a tested person. The micro-fluidic chip and a micro-fluidic passive sweat patch which are prepared from the glucose electrode have excellent performance and wide application prospect.
Owner:SOUTH UNIVERSITY OF SCIENCE AND TECHNOLOGY OF CHINA

Seedling growing method for breaking dormancy of Radix Tinosporae seeds

The invention discloses a seedling growing method for breaking the dormancy of Radix Tinosporae seeds. The method comprises the following steps: 1, soaking Radix Tinosporae seed kernels, obtained after removing seed coats, in a sulfuric acid solution having a volume concentration of 60% for 5-6 min, and washing the soaked seed kernels with tap water; 2, refrigerating the processed Radix Tinosporaeseed kernels obtained in step 1 at 2-4 DEG C for 15-20 d, then wrapping the seed kernels with humid river sands, standing the wrapped seed kernels at 15-25 DEG C for 5-10 d, taking out the Radix Tinosporae seed kernels, and refrigerating the seed kernels at 4-6 DEG C for 15-20 d; and 3, performing disinfection treatment and germination accelerating treatment on the processed Radix Tinosporae seedkernels obtained in step 2, and transplanting the germinated Radix Tinosporae seed kernels into a seedbed. The method has the advantages of shortening of the germination time of the Radix Tinosporaeseed kernels and improvement of the germination rate.
Owner:GUANGXI BOTANICAL GARDEN OF MEDICINAL PLANTS

Ultrasonic vital energy and blood circulation massage health-care helmet device

The invention relates to an ultrasonic vital energy and blood circulation massage health-care helmet device. The ultrasonic vital energy and blood circulation massage health-care helmet device comprises a front half helmet shell, a rear half helmet shell, a front ultrasonic air bag module, a rear ultrasonic air bag module and a controller mechanism; the front ultrasonic air bag module is arrangedon the inner cavity wall of the front half helmet shell; the rear ultrasonic air bag module is arranged on the inner cavity wall of the rear half helmet shell; the front half helmet shell and the rearhalf helmet shell are hinged and covered together; and the controller mechanism consists of a main case, a PLC circuit control board, an electric inflator pump, an electromagnetic switch valve, a barometer and an ultrasonic generator. According to the helmet device, the whole head and the face of a human body can be completely wrapped with the airbags in a fitted manner, wearing is comfortable, the whole head and the face of the human body are subjected to ultrasonic vibration massage through an ultrasonic transducer, skin and hair are not damaged, and the helmet device has good health-care efficacy in promoting blood circulation of the whole head and face, soothing nerves, relieving fatigue, maintaining human metabolism and the like.
Owner:彭志军

Ear-hanging device equipped by electric power regulation and control attendant

ActiveCN105303773ARegain consciousnessCause traumaAlarmsSleep stateElectrical battery
The invention discloses an ear-hanging device equipped by an electric power regulation and control attendant, comprising an ear-hanging main body which is of a cavity structure; one end of the ear hanging device is provided with a hook body bending toward the ear-hanging main body; the other end of the ear-hanging main body is provided with a battery chamber; an indication lamp panel is positioned on the upper part of the end surface, which is on the contrary to one end surface of the ear-hanging main body corresponding to the hook body; the middle part of the end surface is provided with a switch panel; the free end of the hook is provided with a buzzer; an inclination angle sensor and a programming controller which are mutually connected are arranged inside the cavity of the ear-hearing main body; and the inclination angle sensor is provided with a normally open contact switch which is connected to the programming controller. The ear-hanging device disclosed by the invention wakes up the regulation and control attendant who is about to go into a deep sleep state through deflection sensing of the inclination angle sensor and the programming controller controlling the working state of the buzzer, and enables the attendant to focus and finish the detection work.
Owner:国网山东济南市历城区供电公司 +1

miRNA related to colorectal cancer and application thereof

The invention belongs to the field of nucleic acid diagnosis and treatment, and particularly relates to miRNA related to colorectal cancer and application thereof. The miRNA related to colorectal cancer is miR-1290. The invention provides application of the miR-1290 in preparing a kit for distinguishing a colorectal cancer sample and a rectal cancer sample from a normal sample in a blood sample ofa subject. The invention determines that the miR-1290 is a miRNA diagnostic marker related to colorectal cancer for the first time, and establishes a novel colorectal cancer and rectal cancer tumor progression detection index. On the basis, the invention provides novel application of the miR-1290 in the aspect of initial diagnosis and rapid detection of colorectal cancer and rectal cancer and a related universal applicable kit.
Owner:GUANGZHOU FULENGEN

A sex-differential expression label and kit for tongue sole exosomes

The present invention relates to a semi-smooth tongue sole exosome gender difference expression label and a kit, which belong to the field of fish biotechnology. The microRNA sex label is dre-miR-10d-5p, and the sequence is TACCCTGTAGAACCGAATGTGTG; to solve the problem of semi-smooth tongue sole male fish and pseudo-male The problem of distinguishing genetic differences in reproduction in fish. The marked miRNAs have the characteristics of significant differential expression in male fish and pseudo-male fish, and are specific molecular recognition markers.
Owner:TIANJIN BOHAI SEA FISHERIES RES INST

Application of klk13 in the preparation of a detection kit for diagnosing cervical adenocarcinoma

The invention discloses the application of KLK13 in the preparation of a detection kit for diagnosing cervical adenocarcinoma. KLK13 can be used as a diagnostic marker for cervical adenocarcinoma. The expression of KLK13 in HeLa cervical cancer cells is interfered with by siRNA, and the MTT cell proliferation test and the cell scratch test are respectively It showed that the proliferation and migration ability of cervical cancer cells were significantly increased compared with the control group.
Owner:NANJING MATERNITY & CHILD HEALTH CARE HOSPITAL

Mesoporous sponge spicule as well as preparation method and application of mesoporous sponge spicule

The invention discloses a mesoporous sponge spicule. The mesoporous sponge spicule is prepared by modifying the surface of the sponge spicule with a mesoporous material. The sponge spicule, especiallya sponge haliclona spicule (SHS), can penetrate into the cuticle of the skin to open the skin barrier, and stay in the cuticle of the skin for a long time to form a large number of continuous micro-channels which are far longer than the duration of the micro-channels after the traditional micro-needles act on the skin. The mesoporous sponge spicule (mSS), especially the surface of the mesoporoussponge haliclona spicule (mSHS), is modified with the mesoporous material, so that various drugs, especially insoluble drugs or bioactive components, can be adsorbed and loaded, and the drug loading capacity is improved. In this way, loaded medicines or bioactive components can enter the skin along with the mesoporous spicule and then are released to the deep layer of the skin from the mesoporouslayer.
Owner:XIAMEN UNIV

A system and method for detecting components of animal excrement

The invention relates to the technical field of animal breeding, in particular to a system and method for detecting the composition of animal excrement. The system for detecting the composition of the animal excrement comprises an excrement collecting and judging device, an image acquisition device, a color analysis chip, a data processing chip and a power supply device. The collected animal excrement reacts with chemical matter to generate the color change; color analysis data is generated from image information through a vision algorithm, the color analysis data is compared with preset composition information of the animal excrement, the current composition information of the animal excrement is determined, and breeding information is output according to the current composition information. According to the system and method for detecting the composition of the animal excrement, the composition of the animal excrement can be accurately and rapidly detected, corresponding treatment suggestions are given, and a feeder can accurately grasp the feeding status of animals in time and scientifically perform treatment.
Owner:SHENZHEN LINKMIAO ROBOT TECH CO LTD

Imaging detection system and method for advanced cancer based on quantum superstring engine

The invention discloses an intermediate-advanced stage cancer imaging detecting system and an intermediate-advanced stage cancer imaging detecting method based on the quantum superstring engine, mainly used for overcoming the defect that the traditional medical device can not efficiently, safely, rapidly and comprehensively detect the cancer cell spreading area of a cancer patient. The intermediate-advanced stage cancer imaging detecting system comprises a quantum light emission source, an optical splitter, a convex lens, a light filter group, a detection unit, an image processing unit and a display. The intermediate-advanced stage cancer imaging detecting method comprises the steps that orthogonal polarized photons generated by the quantum light emission source pass through the optical splitter, and then are transmitted in two paths; one path of the orthogonal polarized photons irradiates the body of the patient through the convex lens and light filters, penetrates through the body and then is received by a detector, and the other path of the orthogonal polarized photons directly passes through the light filters, and are received by another detector; the detection unit carries out combined measurement on the photons detected by the two detectors, and outputs a detection result to the image processing unit, the image processing unit draws a diffusion area imaging picture of cancer cells in the body of the patient, and the diffusion area imaging picture is displayed by the display. With the adoption of the intermediate-advanced stage cancer imaging detecting system and the intermediate-advanced stage cancer imaging detecting method, the diffusion area imaging picture of the cancer cells can be obtained, and thus a basis is provided for the treatment and research on the cancer patient.
Owner:XIAN UNIV OF POSTS & TELECOMM

Central venous pressure measurement method and related device

The application discloses a method for measuring central venous pressure and related devices, which are applied to electronic equipment including a vein identification module. The method includes: collecting pulsation image data of the vein on the right side of the neck through the vein identification module; An upscaling algorithm processes the pulsatile image data to obtain pulsatile motion information; and determines central venous pressure based on the pulsatile motion information. The central venous pressure can be measured without damage by using the embodiment of the present application.
Owner:GUANGDONG OPPO MOBILE TELECOMM CORP LTD

Snake-proof henhouse for breeding mountain chickens

The invention discloses a snake-proof henhouse for breeding mountain chickens. The henhouse comprises a henhouse body, a movable doorplate, a device for preventing snake crawling, a snake-proof pit, asnake-killing door, an illumination-ventilation device, and a feeding device. The device for preventing snake crawling is arranged on the outer wall of the henhouse body and two sides of the movabledoorplate. The snake-proof pit is arranged close to the movable doorplate. The illumination-ventilation device and the feeding device are both arranged in the henhouse body. The movable doorplate is movably arranged on one surface of the henhouse body. The movable doorplate is movably connected to the henhouse body through a rotation shaft. The device for preventing snake crawling comprises a fixed rod. The fixed rod is fixedly connected to the outer wall of the henhouse body. The provided snake-proof henhouse can prevent snakes from entering the henhouse, the mountain chickens and eggs are protected effectively, the loss is reduced, in the henhouse, mountain chickens can exercise through small earth mounds, a first support rod and a second support rod, and the taste of chicken is improved.
Owner:HEFEI HAOWANG AQUACULTURE TECH CO LTD

piRNA (piwi-interacting ribonucleic acid) biomarkers for noninvasive early-stage diagnosis on colon cancer and rectal cancer and detection kit

The invention discloses piRNA (piwi-interacting ribonucleic acid) biomarkers for noninvasive early-stage diagnosis on colon cancer and rectal cancer and a detection kit. The piRNA biomarkers comprisepiRNA020619 and piRNA020450. The expression amounts of the two piRNA biomarkers in serum of patients suffering from colon cancer and rectal cancer are remarkably higher than those in serum of healthypeople, and the piRNA biomarkers have very high sensitivity and specificity when being adopted to diagnose colon cancer and rectal cancer. By adopting the kit disclosed by the invention, serum samplesof patients suffering from colon cancer and rectal cancer and serum samples of healthy people can be rapidly and accurately distinguished.
Owner:内蒙古医科大学附属人民医院

Living body sampler and drill applicable to living body sampler

The invention relates to a living body sampler and a drill applicable to the living body sampler. The living body sampler comprises a handheld drill gun, wherein a sampling insertion tube is mounted on a housing of the handheld drill gun; the handheld drill gun is provided with a rotating gun head; a sampling insertion rod is mounted on the rotating gun head and located in the sampling insertion tube; the sampling insertion rod and / or the sampling insertion tube are / is detachably connected with the handheld drill gun; a drill is arranged at the front end of the sampling insertion rod and comprises a drill shaft and at least one cutting blade arranged at the end part of the drill shaft; cutting edges of the cutting blades extend outwards from an axis of the drill shaft radially and achievecutting through the end faces of the cutting edges; the cutting edges of the cutting blades come out of the sampling insertion tube; and a sample storage cavity for accommodating tissue and organ samples is defined by the drill on the inner sides of the cutting blades, and the sampling insertion tube. The living body sampler achieves cutting and sampling through rotation of the adapted drill; thedrill can be clung to the surface of an organ for sampling; and therefore, injuries to the living body organ are reduced.
Owner:HENAN AGRICULTURAL UNIVERSITY

Central venous pressure measuring method and related device

ActiveCN110215198ACause traumaDiagnostics using lightEvaluation of blood vesselsVeinCentral venous pressure measurement
The invention discloses a central venous pressure measuring method and a related device applied to electronic equipment comprising a vein recognition module. The method comprises the steps of collecting pulsation image data of the neck right side vein through the vein recognition module; calling the pulsation image data processed through a motion amplification algorithm to obtain pulsation motioninformation; on the basis of the pulsation motion information, determining the central venous pressure. By applying the embodiment, the central venous pressure can be measured with no damage.
Owner:GUANGDONG OPPO MOBILE TELECOMM CORP LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products