Cynoglossus semilaevis exosome gender difference expression label and kit

Abstract

The invention relates to a cynoglossus semilaevis exosome gender difference expression label and a kit, belonging to the field of fish biotechnology. A micro ribonucleic acid (miRNA) gender label is dre-miR-10d-5p, and a sequence is TACCCTGTAGAACCGAATGTGTG; the problem of distinguishing reproductive genetic differences between male cynoglossus semilaevis and female pseudo-male cynoglossus semilaevis is solved. The marker miRNAs have the characteristic of significant difference expression of male fish and female pseudo-male fish, and are specific molecular recognition markers.

Description

Technical field [0001] The invention belongs to the field of fish biotechnology, especially the application field of marine fish semen exosomes markers, and specifically is a semi-smooth tongue sole exosomes gender differential expression label and kit. Background technique [0002] The growth rate of male and female semi-smooth tongue soles varies greatly, and pseudo-males exist to varying degrees in nature and in the breeding environment. The chromosomes of pseudo-male fish are ZW type, and its reproductive organs are the same as male fish, which can also produce sperm and breed offspring. Pseudo-male fish can also accumulate from generation to generation through genetics, which leads to an imbalance in the male-to-male ratio of semi-smooth tongue sole. Therefore, the development of a method for identifying the pseudo-male semi-smooth tongue sole not only has theoretical significance, but also has production value and market value. [0003] There are many ways to identify fish ...

AI Technical Summary

Problems solved by technology

Although some methods are simple and easy to implement, the results may not be accurate, and some methods require dissection of fish

Images