Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A sex-differential expression label and kit for tongue sole exosomes

A technique of semi-smooth tongue sole and exosomes, which is applied in the field of gender differential expression tags and kits of semi-smooth tongue sole exosomes, can solve the problems of inaccurate results and the like, and achieve the effect of reliable identification results.

Inactive Publication Date: 2021-04-27
TIANJIN BOHAI SEA FISHERIES RES INST
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although some methods are simple and easy to implement, the results may not be accurate, and some methods require dissection of fish

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A sex-differential expression label and kit for tongue sole exosomes
  • A sex-differential expression label and kit for tongue sole exosomes
  • A sex-differential expression label and kit for tongue sole exosomes

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0021] Screening and identification of a semi-smooth tongue sole seminal exosomal miRNAs as biomarkers

[0022] 1. Collection of semen samples Collect the semen of 50 adult males and pseudo-male of semi-smooth tongue sole, and take 0.5ml of semen from each in a centrifuge tube for exosome isolation and identification.

[0023] 2. Extraction of exosomes

[0024] (1) Transfer 0.5ml of the semen sample to a 1.5ml EP tube, place at 4°C, centrifuge at 1200g for 15min to remove sperm cells, centrifuge at 15000g at 4°C for 20min to remove small cell impurities and debris, dilute 1 time with PBS, and use a 0.45um filter membrane Perform pre-filtration, and then filter the filtrate through a 0.22um membrane filter.

[0025] (2) Exosomes were extracted from the sample using the SBI ExoQuick-TC for Tissue Culture Media and Urine kit.

[0026] (3) After centrifugation, the supernatant was removed, and the lysed sample was collected and completely transferred to a RNase-free 2ml tube.

...

Embodiment 2

[0033] Identification of male fish and pseudo-male fish using microRNA markers in the seminal plasma exosomes of semismooth tongue sole

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention relates to a semi-smooth tongue sole exosome gender difference expression label and a kit, which belong to the field of fish biotechnology. The microRNA sex label is dre-miR-10d-5p, and the sequence is TACCCTGTAGAACCGAATGTGTG; to solve the problem of semi-smooth tongue sole male fish and pseudo-male The problem of distinguishing genetic differences in reproduction in fish. The marked miRNAs have the characteristics of significant differential expression in male fish and pseudo-male fish, and are specific molecular recognition markers.

Description

technical field [0001] The invention belongs to the field of fish biotechnology, in particular to the application field of seawater fish semen exosome markers, and specifically relates to a gender-differential expression label and kit for tongue sole exosomes. Background technique [0002] There is a huge difference in the growth speed of the female and male fishes of semi-smooth tongue sole, and pseudo-male fishes exist to varying degrees in both nature and aquaculture environments. The chromosome of the pseudo-male fish is ZW type, and its reproductive organs are the same as the male fish, which can also produce sperm and reproduce offspring. Pseudo-male fish can also accumulate from generation to generation through inheritance, which leads to an imbalance in the ratio of male to female in half-smooth tongue sole. Therefore, it is not only of theoretical significance, but also of production value and market value to develop a method for identifying the pseudo-male of half...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/6879
CPCC12Q1/6879C12Q2600/158C12Q2600/166C12Q2600/178
Inventor 张博贾磊赵娜李仰真刘克奉高磊高燕
Owner TIANJIN BOHAI SEA FISHERIES RES INST
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com