Patents
Literature
Hiro is an intelligent assistant for R&D personnel, combined with Patent DNA, to facilitate innovative research.
Hiro

33 results about "Toxin binding" patented technology

A toxin binder is a supplement that can attach itself to a toxic substance and render it harmless while escorting it out of the body through the digestive or urinary tract. Many of these binders are so effective they can actually render various poisonous substances harmless.

Toxin conjugated eph receptor antibodies

The present invention relates to compositions and methods for inducing cell death or stasis in cancer cells or other hyperproliferative cells using anti-EphA2 or anti-EphA4 antibodies conjugated to toxins.
Owner:SEATTLE GENETICS INC +1

Oral delivery systems for microparticles

PCT No. PCT / AU92 / 00141 Sec. 371 Date Nov. 30, 1992 Sec. 102(e) Date Nov. 30, 1992 PCT Filed Apr. 2, 1992 PCT Pub. No. WO92 / 17167 PCT Pub. Date Oct. 15, 1992There are disclosed complexes and compositions for oral delivery of a substance or substances to the circulation or lymphatic drainage system of a host. The complexes of the invention comprise a microparticle coupled to at least one carrier, the carrier being capable of enabling the complex to be transported to the circulation or lymphatic drainage system via the mucosal epithelium of the host, and the microparticle entrapping or encapsulating, or being capable of entrapping or encapsulating, the substance(s). Examples of suitable carriers are mucosal binding proteins, bacterial adhesins, viral adhesins, toxin binding subunits, lectins, Vitamin B12 and analogues or derivatives of Vitamin B12 possessing binding activity to Castle's intrinsic factor.
Owner:ACCESS PHARMA

Anti-cldn6 antibody

The present invention relates to an antibody binding to Claudin6 (CLDN6) expressed on a cell membrane. The antibody of the present invention recognizes human CLDN6 present in a native form on cell membrane surface and exhibits cytotoxicity through ADCC and / or CDC activities against cancer cell lines highly expressing human CLDN6. Moreover, the antibody of the present invention has cell growth inhibitory effect through conjugation with toxin on cancer cell lines highly expressing human CLDN6. The human CLDN6 is overexpressed in tumor tissues (lung adenocarcinoma, gastric cancer, and ovarian cancer), although its expression is not observed in normal tissues. Thus, the anti-CLDN6 antibody is expected to highly accumulate in tumors highly expressing human CLDN6 and can serve as a very effective antitumor agent.
Owner:CHUGAI PHARMA CO LTD +1

Toxin conjugated eph receptor antibodies

The present invention relates to compositions and methods for inducing cell death or stasis in cancer cells or other hyperproliferative cells using anti-EphA2 or anti-EphA4 antibodies conjugated to toxins.
Owner:MEDIMMUNE LLC +1

Preparation of highly pure toxin fragments

Toxin derivatives are prepared by proteolytic treatment of holotoxin, and their toxicity is reduced by contacting the preparation with a ligand, which can be a metal or an antibody or another ligand. This ligand selectively binds to the toxin but not to the toxin derivative. Removing the ligand and toxin bound to the ligand further reduces toxicity. A second ligand is used to remove conjugates of the toxin and the first ligand. Compositions contain the purified derivative, optionally plus the toxin and the ligand.
Owner:THE UK SEC FOR HEALTH & HER BRITANNIC MAJESTYS GOVERNMENT OF THE UK OF GREAT BRITAIN & NORTHERN IRELAND

Designer Ubiquitin Ligases For Regulation Of Intracellular Pathogenic Proteins

The present invention relates to a designer or recombinant ubiquitin ligase molecule that includes a toxin binding domain that is specific for a toxin active fragment, wherein the toxin active fragment is an enzymatically active fragment of one or more toxins or toxin serotypes; and an E3-ligase domain that comprises an E3-ligase or polypeptide that facilitates E2-mediated ubiquitination of the toxin active fragment. In an embodiment, the composition further includes a delivery system that allow the designer ubiquitin ligase to enter the cell. The present invention further includes methods for treating an individual intoxicated with a toxin by administering the designer ubiquitin ligase of the present invention.
Owner:SYNAPTIC RES

Toxin binding compositions

Methods and compositions for the treatment of toxin-mediated diseases are provided herein. One aspect of the invention is oligosaccharide-based therapeutics that interact with toxins and methods of uses thereof. In one embodiment the oligosaccharide-based therapeutics of the invention comprise polymeric particles with attached oligosaccharide binding moieties. The compositions of the invention can be used in the treatment of toxin-mediated diseases such as antibiotic-associated diarrhea and pseudomembranous colitis, including Clostridium difficile associated diarrhea.
Owner:ILYPSA

Compounds and methods for the treatment of bacterial dysentery using antibiotics and toxin binding oligosaccharide compositions

This invention relates to the treatment of diarrhea and related conditions caused by pathogenic E. coli infection. More specifically, this invention is drawn to the unexpected discovery that by administering a composition which binds and removes the shiga like toxins (SLT) produced by pathogenic E. coli whenever an antibiotic is administered, improved treatment is provided. Novel compositions containing both antibiotic and toxin binding composition and methods of treatment which use simultaneous administration toxin binding composition whenever antibiotic is administered are provided. These compositions and methods kill the enteric E. coli organisms which produce the conditions and neutralize the SLT produced by the organisms and / or released from the organisms when they are killed. Thus, these compositions and methods are better able to ameliorate the symptoms of the infection and inhibit progression of this infection into hemolytic uremic syndrome (HUS) than conventional treatment.
Owner:SYNSORB BIOTECH INC

Identification of toxin-binding protein involved in resistance to Cry1 toxins, and related screening methods

The subject invention relates in part to the surprising and unexpected discovery that insects that are resistant to Bacillus thuringiensis Cry toxins have measurably altered alkaline phosphatase (ALP) activity as compared to insects that are susceptible to Cry toxins. This and other surprising discoveries reported herein have broad implications in areas such as managing and monitoring the development of insect resistance to B.t. toxins. For example, the subject invention provides a simple and fast assay (enzymatic or otherwise) for detecting ALP activity levels and thereby monitoring the development of resistance by insects to crystal protein insect toxins. There was no prior motivation or suggestion to go about resistance monitoring using this simple and easy approach.
Owner:UNIV OF GEORGIA RES FOUND INC

Toxin binding compositions

Methods and compositions for the treatment of toxin-mediated diseases are provided herein. One aspect of the invention is oligosaccharide-based therapeutics that interact with toxins and methods of uses thereof. In one embodiment the oligosaccharide-based therapeutics of the invention comprise polymeric particles with attached oligosaccharide binding moieties. The compositions of the invention can be used in the treatment of toxin-mediated diseases such as antibiotic-associated diarrhea and pseudomembranous colitis, including Clostridium difficile associated diarrhea.
Owner:ILYPSA

Water-soluble electrolyzed/hydrolyzed clinoptilolite fragments and nutraceutical, pharmaceutical, and environmental products based thereon

Methods and processes are provided to make clinoptilolite into a water-soluble hydrolyzed form with electrolytes suitable for various administration routes for use in the detoxification and rejuvenation in environment arena, nutraceutical arena, and pharmaceutical arena This process includes oral, topical, tablet, pill formulas, biotech delivery and intravenous. Absorption of water-soluble hydrolyzed clinoptilolite fragments can aid in detoxification by binding to heavy metals, viruses and environmental toxins and can reduce reactive oxygen species and inflammation related to metals. The process and method described can provide an increase in energy, increase in growth factors that aid in hair, skin, and nail growth, and can provide an increase in focus, concentration, and memory. Water-soluble hydrolyzed, electrolyzed clinoptilolite fragments can be combined with one or more dietary supplements, including various vitamins, minerals, and sleep aids to rejuvenate the cells and the environment during and after detoxification.
Owner:ENTOX SOLUTIONS LLC

NOVEL CADHERIN RECEPTOR PEPTIDE FOR POTENTIATING Bt BIOPESTICIDES

Disclosed is a novel cadherin peptide that enhances the toxicity of Cry proteins. A novel insecticide composition comprising an effective amount of cadherin peptide having SEQ. ID. NO:2 and an effective amount of Bacillus thuringiensis Cry protein wherein the cadherin peptide comprises a Cry3Aa toxin binding region from the full-length T. molitor cadherin and has synergistic characteristics of a binary toxin potentiating Cry3 and Cry1 toxins against coleopterans and lepidopteran species, respectively
Owner:US SEC AGRI +1

Toxin binding system

In some embodiments, a composition and / or method may include a toxin binding system formulated for safe and effective mixture into various feed rations which are fed to monogastric and ruminant animals such as poultry, swine, cows, cattle, and fish, among others. The toxin binding system includes novel combinations of one or more of an organoclay, an activated hydrated sodium calcium aluminosilicate clay, and a synthetic hectorite clay. In some embodiments, the binding composition may include organoclay, bentonite, hectorite, Leonardite, and / or any combination thereof. The toxin binding complex may effectively bind mycotoxins, endotoxins and some pesticides in the animal's digestive system, preventing their absorption and the consequent damages to the animal. This binding action includes the T-2 toxin, which can start their damaging action in the animal's mouth, hence, offering protection from oral lesions.
Owner:SPECIAL NUTRIENTS LLC

Aptamer C201 of staphylococcal enterotoxin C2 as well as screening method and application of aptamer C201

The invention relates to an aptamer C201 of staphylococcal enterotoxin C2 as well as a screening method and application of aptamer C201. The aptamer C201 has a sequence of AGGGCCGAGCTCACTTGTACATAGGTCCATTAGCAGGAGCGTAAGCTAAGGCCCCGCCGGCACAATTGTGC. The screening method comprises the following steps: utilizing carboxyl magnetic beads as solid phase media based on an in-vitro SELEX screening technology of the aptamer, taking staphylococcal enterotoxin C2 as a target, screening from an ssDNA library by virtue of the staphylococcal enterotoxin C2 magnetic beadsso as to obtain the aptamer which is specifically bound to the staphylococcal enterotoxin C2. The aptamer C201 disclosed by the invention has the advantage of binding with the staphylococcal enterotoxin C2 at high affinity and high specificity.
Owner:FUZHOU GENERAL HOSPITAL OF NANJING MILITARY COMMAND P L A

Cross-reactive Staphylococcus aureus antibody

The subject relates to a cross-neutralizing antibody comprising at least one polyspecific binding site that binds to alpha-toxin (Hla) and at least one of the bi-component toxins of Staphylococcus aureus, its medical and diagnostic use, method of producing the antibody, including an isolated nucleotide sequence, plasmids and host cells as used in the production of the antibody; and further an isolated conformational epitope recognized by a specific cross-neutralizing antibody.
Owner:ARSANIS BIOSCI

Aptamer C202 of staphylococcus aureus enterotoxin C2 as well as screening method and applications thereof

The invention relates to aptamer C202 of staphylococcus aureus enterotoxin C2 as well as a screening method and applications of the aptamer C202. The aptamer C202 has the sequence as follows: AGGGCCGAGCTCACTTGTCACGGGCACCCTAACTGGGAGGAGGCAGGATAACACCGCCGGCACAATTGTGC. The screening method comprises the step of carrying out screening from an ssDNA library through staphylococcus aureus enterotoxin C2 magnetic beads based on the in-vitro SELEX screening technology of the aptamer and by taking carboxylic magnetic beads as the solid-phase medium and staphylococcus aureus enterotoxin C2 as the target, and thus the aptamer in specific binding with the staphylococcus aureus enterotoxin C2 is obtained. The aptamer C202 provided by the invention can be bond to the staphylococcus aureus enterotoxin C2 with high affinity and high specificity.
Owner:FUZHOU GENERAL HOSPITAL OF NANJING MILITARY COMMAND P L A

Method of improving immune function in mamals using lactobacillus reuteri strains

The invention herein is related to the use of Lactobacillus reuteri strains as immune enhancing agents, methods of improving immune-function in mammals using Lactobacillus reuteri strains in products containing cells of such strains and the products as such. These strains exhibit good toxin binding and neutralizing effect, and exhibit good CD4+ cell recruitment.
Owner:KANG HO JIN +3

Aptamer C203 of staphylococcal enterotoxin C2, screening method and application thereof

The invention relates to an aptamer C203 of staphylococcal enterotoxin C2, a screening method and an application thereof. The sequence of the aptamer C203 is AGGGCCGAGCTCACTTGTCAGGTCGCCTCTTGCGCGGCGCACGGGCGGAAACGCCGCCGGCACAATTGTGC; the screening method of the aptamer C203 comprises the steps that the SELEX screening technology in vitro based on the aptamer uses carboxyl magnetic beads as a solid phase media, the staphylococcal enterotoxin C2 is used as a target, by the staphylococcal enterotoxin C2 magnetic beads, the aptamer specifically binding with the staphylococcal enterotoxin C2 is screened and obtained from the ssDNA library; the aptamer C203 is capable of binding with the staphylococcal enterotoxin C2 in a highly affiliative and highly specific mode.
Owner:FUZHOU GENERAL HOSPITAL OF NANJING MILITARY COMMAND P L A

Pectinophora gossypiella (pink bollworm) Bacillus thuringiensis toxin receptor BT-R2

A cDNA encoding a 200 kD receptor, BT-R2, from the pink boll worm, Pectinophora gossypiella, that binds specifically to a Bacillus thuringiensis toxin has been cloned, sequenced and characterized. The minimum toxin binding fragment has been identified. The BT-R2 cDNA permits the analysis of receptors in pink boll worm and other insects that affect crop growth and development, as well as, design assays for the cytotoxicity and binding affinity of potential pesticides. The clone and other methods described herein, permit the manipulation of natural and / or introduced homologous receptors and, thus, to specifically destroy organisms, tissues and / or cells of the target host.
Owner:BOARD OF RGT THE UNIV OF TEXAS SYST

Method for detecting the presence of one or more bacterial toxins in a biological fluid using liposomes

The present invention relates to a method for detecting the presence of one or more bacterial toxins, capable of binding to cell membranes, in biological fluid wherein the method comprises: (i) incubating the biological fluid with a plurality of liposomes, wherein the liposomes comprise a lipid capable of binding to said one or more toxins, to provide one or more liposome-toxin conjugate; (ii) incubating said conjugates with at least one type of antibody bound to a label to provide one or more conjugate-antibody complex; wherein each type of antibody in the mixture is specific for one of the bacterial toxins whose presence is to be detected; and (iii) analysing said complexes in order to detect the presence of one or more bacterial toxins capable of binding to cell membranes. Further aspects of the invention relate to a conjugate-antibody complex useful in the methods of the invention and a kit useful for performing the method of the invention.
Owner:UNIV OF LIVERPOOL

Rodenticide binding system

ActiveUS20180092354A1Safely and effectively mixedSafely and effectively mixed into animal feedBiocideInanimate material medical ingredientsRuminant animalOrganoclay
In some embodiments, a composition and / or method may include a rodenticide binding system formulated for safe and effective mixture into various feed rations which are fed to monogastric and ruminant animals such as poultry, swine, cows, cattle, and fish, among others. The rodenticide binding system includes novel combinations of one or more of an organoclay, an activated hydrated sodium calcium aluminosilicate clay, and a synthetic hectorite clay. In some embodiments, the binding composition may include organoclay, bentonite, hectorite, Leonardite, and / or any combination thereof. The toxin binding complex may effectively bind some pesticides (e.g., rodenticides) in the animal's digestive system, preventing their absorption and the consequent damages to the animal.
Owner:SPECIAL NUTRIENTS LLC

Method for rapidly detecting T-2 toxin in food based on nucleic acid hydrogel

The invention belongs to the technical field of food detection, and discloses a method for rapidly detecting T-2 toxin in food based on nucleic acid hydrogel. The method comprises the following stepsof constructing the nucleic acid hydrogel by taking T-2 toxin aptamer as a linker cross-linking agent, wherein the horseradish peroxidase is uniformly embedded in the nucleic acid hydrogel; adding a to-be-detected sample into the nucleic acid hydrogel, wherein the concentration of the T-2 toxin in the to-be-detected sample is 0.01ng mL<-1>-10000ng mL<-1>, and the T-2 toxin aptamer is combined withthe T-2 toxin, the gel is broken to release the horseradish peroxidase; and enabling the horseradish peroxidase to catalyze hydrogen peroxide and potassium iodide within time to react to generate iodine simple substance etched gold nanorods, and computing the content of the T-2 toxin according to an absorption peak of the gold nanorods under an ultraviolet spectrophotometer. The method disclosedby the invention is convenient and sensitive to detect.
Owner:TIANJIN UNIVERSITY OF SCIENCE AND TECHNOLOGY

Anti-staphylococcus aureus antibody combination preparation

An anti-Staphylococcus aureus antibody combination preparation comprising a) a toxin cross-neutralizing antibody comprising at least one polyspecific binding site that binds to alpha-toxin (Hla) and at least one of the bi-component toxins selected from the group consisting of HIg AB, HIg CB, LukSF, LukED, Luk S-Hlg B, LukSD, HIg A-LukD, HIg A-LukF, Luk EF, LukE-Hlg B, HIg C-LukD and HIg C-LukF; and b) an anti-Luk GH antibody;; and / or c) an OPK antibody which recognizes a S. aureus surface protein thereby inducing OPK, specifically an anti-Ig-binding protein (IGBP) antibody comprising at leastone CDR binding site recognizing any of the S. aureus Ig G binding domains of Protein A or Sbi.
Owner:ARSANIS BIOSCI

Rice leaf roller cadherin Cry toxin binding region coding gene as well as coding protein and application thereof

The invention discloses a rice leaf roller cadherin Cry toxin binding region coding gene with a nucleotide sequence as shown in SEQ ID NO.14 and a coding protein with an amino acid sequence as shown in SEQ ID NO.15 for the first time. A toxin binding region CmCad-CR6-MPED of rice leaf roller cadherin has a binding effect with Cry1Ac toxin, can be applied to prediction of rice leaf roller Cry toxin resistance. If the nucleotide sequence of the cadherin Cry toxin binding region gene of rice leaf roller to be detected is different from SEQ ID NO.14, a rice leaf roller receptor is subjected to gene mutation, the binding capacity is reduced, and the insect has certain resistance to Cry toxin. The coding protein can also be used for screening Bt protein aiming at the rice leaf folder; and if the Bt protein to be screened and a code have high affinity, the Bt protein to be screened is inevitably inserted into the midgut BBMV of the rice leaf folder, epithelial cell membrane is broken, and the Bt toxin insecticidal protein with high toxicity to the rice leaf folder can be rapidly screened or modified.
Owner:JIANGSU ACADEMY OF AGRICULTURAL SCIENCES

Medicinal Composition for Total Body Detoxification

A medicinal composition for total body detoxification is administered to a user to remove toxins from the user's body, as well as, provide hangover relief subsequent to the consumption of alcoholic beverages. The medicinal composition includes a quantity of activated charcoal and a quantity of dietary supplements; the quantity of activated charcoal and the quantity of dietary supplements being heterogeneously mixed into an orally-administrable composition. The orally-administrable composition is consumed twice a day or proportionally to the quantity of alcohol consumed. The quantity of activated charcoal binds to toxins during digestion to prevent the uptake of the toxins into the user's body. The quantity of dietary supplements replenishes beneficial nutrients to the user.
Owner:SMITH LISA COMPANIONI

Rodenticide binding system

ActiveUS10729127B2Safely and effectively mixed into animal feedBiocideInanimate material medical ingredientsBiotechnologyMonogastric
In some embodiments, a composition and / or method may include a rodenticide binding system formulated for safe and effective mixture into various feed rations which are fed to monogastric and ruminant animals such as poultry, swine, cows, cattle, and fish, among others. The rodenticide binding system includes novel combinations of one or more of an organoclay, an activated hydrated sodium calcium aluminosilicate clay, and a synthetic hectorite clay. In some embodiments, the binding composition may include organoclay, bentonite, hectorite, Leonardite, and / or any combination thereof. The toxin binding complex may effectively bind some pesticides (e.g., rodenticides) in the animal's digestive system, preventing their absorption and the consequent damages to the animal.
Owner:SPECIAL NUTRIENTS LLC
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products