Patents
Literature
Hiro is an intelligent assistant for R&D personnel, combined with Patent DNA, to facilitate innovative research.
Hiro

204 results about "Skin striae" patented technology

"Striae" is also a general term referring to thin, narrow grooves or channels, or a thin line or band especially if several of them are parallel or close together. Stretch marks, also known as striae, are a form of scarring on the skin with an off-color hue.

Topical Nutraceutical Compositions with Selective Body Slimming and Tone Firming Antiaging Benefits

I have discovered cosmetic or topical pharmaceutical compositions for external body part or organ slimming, firming, cellulite reduction, fat-reduction, and obesity control benefits that are in synergistic combination with benefits for the treatment of skin aging, skin wrinkles reduction, skin exfoliating, treatment of acne, treatment of rosacea, age-spots reduction, skin surface whitening, skin surface brightening striae distensae (stretch marks) reduction, treatment of pimples, treatment of skin infections and lesions, spider veins reduction, blood microcirculation (venous insufficiency) improvement, UVA / UVB protection of skin, and skin redness reduction. These compositions thus provide multiple combinations of skin and external body part or organ enhancement benefits that can be selective and specific for external body parts and organs such as face, chin, cheeks, arms, "love handles" in abdomen area, eye lids and eye zone, neck, breasts, thighs, and hips. These compositions include a body beneficial composition selected from certain nutraceutical, cosmetic, and pharmaceutical ingredients, a composition to promote collagen and elastin synthesis in the skin, and a cosmetically or pharmaceutically acceptable delivery system.
Owner:GUPTA SHYAM K

A micro-rna family that modulates fibrosis and uses thereof

598702 Disclosed is the use of an antisense oligonucleotide for preparation of a medicament for treating pathologies or deficiencies that are characterized by a loss, lack, or underproduction of collagen, wherein the antisense oligonucleotide comprises a sequence that is at least partially complementary to a miR-29a (uagcaccaucugaaaucggu), miR-29b (uagcaccauuugaaaucagu), or miR-29c (uagcaccauuugaaaucggu) sequence. Further disclosed is the use of an antisense oligonucleotide for preparation of a medicament for increasing collagen deposition in a tissue for treatment of natural aging and stretch marks. Further disclosed is a composition formulated for topical administration comprising a pharmaceutically acceptable carrier and an antisense oligonucleotide comprising a sequence that is at least partially complementary to a miR-29a, miR-29b, and / or miR-29c sequence.
Owner:BOARD OF RGT THE UNIV OF TEXAS SYST

Peptides, compositions comprising them and uses in particular cosmetic uses

ActiveUS20170157014A1Improve appearance and general statePrevention of signCosmetic preparationsPeptide/protein ingredientsCell-Extracellular MatrixCollagen i
The peptides have the general following formula: X-Pro*-Pro*-Xaa-Y in which: —Xaa is selected from Leucine (Leu, L), Arginine (Arg, R), Lysine (Lys, K), Alanine (Ala, A), Serine (Ser, S), and Aspartic acid (Asp, D); —At the N terminal end of the peptide, X is selected from H, —CO—R1 and —SO2—R1; —At the C terminal end of the peptide, Y is selected from OH, OR1, NH2, NHR1 and NR1R2; —R1 and R2 are, independently from each other, selected from an alkyle, aryle, aralkyle, alkylaryl, alkoxy and aryloxy group, that can be linear, branched, cyclic, poly-cyclic, non-saturated, hydroxylated, carbonylated, phosphorylated and / or sulfured, and which skeletum can comprise an heteroatom, in particular an O, S and / or N atom;—Pro* correspond to a Proline, an analogue or derivative thereof; —if X is H then Y is selected from OR1, NH2, NHR1 and NR1R2, and if Y is OH then X is —CO— or —SO2—R1; and the peptide hypoxanthine-Pro-Pro-Arg being excluded. The invention provides the use of the peptides of above formula I to stimulate the synthesis of the molecules constituting the dermal extracellular matrix, including collagen I and IV and elastin. A cosmetic treatment according to the invention includes anti-aging, anti-wrinkles, improving mechanical properties of the skin, firmness / tone / elasticity / suppleness / flexibility, increasing density and volume of the skin, restructuring effect, fighting stretch marks, improving skin barrier and / or skin hydration.
Owner:SEDERMA SA

Stem cell extract product for eliminating skin striae gravidarum

The invention provides a stem cell extract product for eliminating skin striae gravidarum, and belongs to the field of stem cell technology. The stem cell extract product derives from stem cells of normal placenta or umbilical cord, and solves the technology problems existing in acquirement of stem cells from embryo and umbilical cord as well as separation of the needed stem cells and the like. The stem cell extract product contains a lot of bioactive factors which are good for skin regeneration and repair, products using the stem cell extract product or using the stem cell extract product as a main component can effectively mitigate or even eliminate skin striae gravidarum and do not irritate skin and do not have adverse reactions.
Owner:国健菁华(深圳)精准健康科技有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products