Patents
Literature
Hiro is an intelligent assistant for R&D personnel, combined with Patent DNA, to facilitate innovative research.
Hiro

210 results about "Stretch marks" patented technology

Stretch marks (striae) can appear when there is rapid stretching of the skin. Stretch marks appear as parallel streaks of red, thinned glossy skin that over time become whitish and scarlike in appearance.

Topical Nutraceutical Compositions with Selective Body Slimming and Tone Firming Antiaging Benefits

I have discovered cosmetic or topical pharmaceutical compositions for external body part or organ slimming, firming, cellulite reduction, fat-reduction, and obesity control benefits that are in synergistic combination with benefits for the treatment of skin aging, skin wrinkles reduction, skin exfoliating, treatment of acne, treatment of rosacea, age-spots reduction, skin surface whitening, skin surface brightening striae distensae (stretch marks) reduction, treatment of pimples, treatment of skin infections and lesions, spider veins reduction, blood microcirculation (venous insufficiency) improvement, UVA / UVB protection of skin, and skin redness reduction. These compositions thus provide multiple combinations of skin and external body part or organ enhancement benefits that can be selective and specific for external body parts and organs such as face, chin, cheeks, arms, "love handles" in abdomen area, eye lids and eye zone, neck, breasts, thighs, and hips. These compositions include a body beneficial composition selected from certain nutraceutical, cosmetic, and pharmaceutical ingredients, a composition to promote collagen and elastin synthesis in the skin, and a cosmetically or pharmaceutically acceptable delivery system.
Owner:GUPTA SHYAM K

A micro-rna family that modulates fibrosis and uses thereof

598702 Disclosed is the use of an antisense oligonucleotide for preparation of a medicament for treating pathologies or deficiencies that are characterized by a loss, lack, or underproduction of collagen, wherein the antisense oligonucleotide comprises a sequence that is at least partially complementary to a miR-29a (uagcaccaucugaaaucggu), miR-29b (uagcaccauuugaaaucagu), or miR-29c (uagcaccauuugaaaucggu) sequence. Further disclosed is the use of an antisense oligonucleotide for preparation of a medicament for increasing collagen deposition in a tissue for treatment of natural aging and stretch marks. Further disclosed is a composition formulated for topical administration comprising a pharmaceutically acceptable carrier and an antisense oligonucleotide comprising a sequence that is at least partially complementary to a miR-29a, miR-29b, and / or miR-29c sequence.
Owner:BOARD OF RGT THE UNIV OF TEXAS SYST

Dressing having the controlled release of active agents

The present invention relates to novel dressings containing polysulfated oligosaccharides and having the controlled release of said active ingredients. The invention also relates to a method for preparing same, wherein the method comprises a treatment step using ethylene oxide. The invention also relates to the uses thereof for caring for wounds and for treating and / or preventing scars and stretch marks.
Owner:LABORATOIRE URGO
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products