115 results about "DNA methyltransferase" patented technology

Quinoline derivatives, particularly 4-anilinoquinoline derivatives, are provided. Such quinoline derivatives can be used for modulation of DNA methylation, such as effective inhibition of methylation of cytosine at the C-5 position, for example via selective inhibition of DNA methyltransferase DNMT1. Methods for synthesizing numerous 4-anilinoquinoline derivatives and for modulating DNA methylation are provided. Also provided are methods for formulating and administering these compounds or compositions to treat conditions such as cancer and hematological disorders.

Quinoline derivatives, particularly 4-anilinoquinoline derivatives, are provided. Such quinoline derivatives can be used for modulation of DNA methylation, such as effective inhibition of methylation of cytosine at the C-5 position, for example via selective inhibition of DNA methyltransferase DNMT1. Methods for synthesizing numerous 4-anilinoquinoline derivatives and for modulating DNA methylation are provided. Also provided are methods for formulating and administering these compounds or compositions to treat conditions such as cancer and hematological disorders.

Quinoline derivatives, particularly 4-anilinoquinoline derivatives of formula (I), are provided:Such quinoline derivatives can be used for modulation of DNA methylation, such as effective inhibition of methylation of cytosine at the C-5 position, for example via selective inhibition of DNA methyltransferase DNMT 1. Methods for synthesizing numerous 4-anilinoquinoline derivatives and for modulating DNA methylation are provided. Also provided are methods for formulating and administering these compounds or compositions to treat conditions such as cancer and hematological disorders.

Quinoline derivatives, particularly 4-(4-(4-(quinolin-4-ylamino)benzamido)phenylthio)pyrrolidine-2-carboxylic acid; 3-(4-(4-(quinolin-4-ylamino)benzamido)phenylthio)pyrrolidine; N-(4-(piperidin-4-ylthio)phenyl)-4-(quinolin-4-ylamino)-benzamide; and N-(4-(piperidin-3-ylthio)phenyl)-4-(quinolin-4-ylamino)-benzamide, or a physiologically acceptable salt thereof, are provided. Such quinoline derivatives can be used for modulation of DNA methylation, such as effective inhibition of methylation of cytosine at the C-5 position, for example via selective inhibition of DNA methyltransferase DNMT1. Methods for synthesizing numerous 4-anilinoquinoline derivatives and for modulating DNA methylation are provided. Also provided are methods for formulating and administering these compounds or compositions to treat conditions such as cancer and hematological disorders.

The invention discloses a method for detecting the activity of DNA methyltransferase based on single-ribonucleotide repair-mediated ligation-dependent cycling signal amplification. The method comprises the following steps: (1) adding a Dam MTase acted hairpin substrate to a resection reaction buffer solution, and carrying out a cleavage reaction to produce a 24-nt product; and (2) adding the cleavage product to an amplification reaction buffer solution, carrying out a cyclic linkage-dependent strand displacement amplification reaction to cyclically generate an enhanced fluorescent signal, anddetecting the intensity of the fluorescent signal to determine the activity of the Dam MTase. The method can effectively inhibit nonspecific amplification independent of a target and a template / primer, so the background signal is greatly reduced, and the index amplification of the signal is finally achieved. The method has a high sensitivity and a high specificity, and the lower detection limit can reach 4.8 * 10<-6> U / mL.

The invention provides a fluorescence real-time quantitative PCR (Polymerase Chain Reaction) detection method of micropterus salmoides ulcer syndrome viruses, comprising the following steps of: designing and synthesizing primers according to noncoding region sequences of DNA methyltransferase 3' sides of the micropterus salmoides ulcer syndrome viruses, previously amplifying 167 bp snippets: an upstream primer PF: 5'-GCTCGTTCGGTTGTGCTGAC-3', a downstream primer PR: 5'-GTGTCTCCCTGGTAGTCTTTCAAAC-3'; also synthesizing a probe PB: 5'-(FAM)ATCTGTGTAACCGCCCGCCGCAAAG(Eclipse)-3' used for fluorescence detection; and judging the content of virus particles contained in a sample according to detected CT (Computed Tomography) value through template DNA extraction and PCR amplified reaction. The invention has the advantages of fast detection and high detection accuracy.

The present invention provides a combination epigenetic factors and bispecific compounds targeting CD33 and CD3 in the treatment of myeloid leukemia, wherein the epigenetic factor is selected from thegroup consisting of histone deacetylase (HDAC) inhibitors, DNA methyltransferase (DNMT) I inhibitors,hydroxyurea, Granulocyte-Colony Stimulating Factor (G-CSF), histone demethylase inhibitors and ATRA (All Trans-retinoic acid). Accordingly, the invention provides a pharmaceutical composition comprising a CD33 targeting compound and at least one epigenetic factor and an epigenetic factor for use in the amelioration and / or treatment of a myeloid leukemia, wherein the epigenetic factor increases the responsiveness of a patient to a CD33 targeting compound. Moreover, the invention provides the use of at least one an epigenetic factor for increasing the responsiveness of a myeloid leukemia patient to a treatment with a CD33 targeting compound, a method for the treatment of a myeloid leukemia,the method comprising the administration of at least one epigenetic factor and a CD33 targeting compound to a patient in the need thereof and a kit comprising a pharmaceutical composition of the invention or an epigenetic factor of the invention and a bispecific CD33 targeting compound.

Bacteria and in particular pathogenic bacteria are treated in a manner which alters the bacteria's native level or activity of DNA methyltransferase (Dam). The alteration results in a change in the bacteria's native level of methylation of adenine in a GATC tetranucleotide which inhibits virulence of the bacteria. Thus, compounds which inhibit proliferation of bacteria are useful in treating bacterial infections.

It relates to the use of compounds of formula (I′), or their pharmaceutically or veterinary acceptable salts, or their stereoisomers or mixtures thereof, as anticancer agents and as agents for generating induced pluripotent stem cells. Compounds of formula (I′), wherein R2′ is an alcoxy group, a hydrocarbon chain or a ring system, and R1, R3, and R4 are as defined herein, are dual inhibitors of histone methyltransferases and DNA methyltransferases. It also relates to the compounds of formula (I′), or their pharmaceutically or veterinary acceptable salts, or their stereoisomers or mixtures thereof, wherein R2′ is phenyl or 5- to 6-membered heteroaromatic ring, both optionally fused to another rings (i.e., compounds of formula (I)). It also relates to pharmaceutical or veterinary compositions containing compounds of formula (I).