Patents
Literature
Hiro is an intelligent assistant for R&D personnel, combined with Patent DNA, to facilitate innovative research.
Hiro

115 results about "DNA methyltransferase" patented technology

In biochemistry, the DNA methyltransferase (DNA MTase) family of enzymes catalyze the transfer of a methyl group to DNA. DNA methylation serves a wide variety of biological functions. All the known DNA methyltransferases use S-adenosyl methionine (SAM) as the methyl donor.

Quinoline derivatives for modulating DNA methylation

InactiveUS20090285772A1Reduction in function/activityReduced activityBiocideOrganic chemistryCytosineDNA methylation
Quinoline derivatives, particularly 4-anilinoquinoline derivatives, are provided. Such quinoline derivatives can be used for modulation of DNA methylation, such as effective inhibition of methylation of cytosine at the C-5 position, for example via selective inhibition of DNA methyltransferase DNMT1. Methods for synthesizing numerous 4-anilinoquinoline derivatives and for modulating DNA methylation are provided. Also provided are methods for formulating and administering these compounds or compositions to treat conditions such as cancer and hematological disorders.
Owner:SUPERGEN

Quinoline derivatives for modulating DNA methylation

Quinoline derivatives, particularly 4-anilinoquinoline derivatives, are provided. Such quinoline derivatives can be used for modulation of DNA methylation, such as effective inhibition of methylation of cytosine at the C-5 position, for example via selective inhibition of DNA methyltransferase DNMT1. Methods for synthesizing numerous 4-anilinoquinoline derivatives and for modulating DNA methylation are provided. Also provided are methods for formulating and administering these compounds or compositions to treat conditions such as cancer and hematological disorders.
Owner:SUPERGEN

Quinoline derivatives for modulating DNA methylation

InactiveUS20080175814A1Reduction in function/activityReduced activityBiocidePeptide/protein ingredientsDNA methylationCytosine
Quinoline derivatives, particularly 4-anilinoquinoline derivatives, are provided. Such quinoline derivatives can be used for modulation of DNA methylation, such as effective inhibition of methylation of cytosine at the C-5 position, for example via selective inhibition of DNA methyltransferase DNMT1. Methods for synthesizing numerous 4-anilinoquinoline derivatives and for modulating DNA methylation are provided. Also provided are methods for formulating and administering these compounds or compositions to treat conditions such as cancer and hematological disorders.
Owner:SUPERGEN

Inhibitors of DNA Methyltransferase

The invention relates to the inhibition of DNA methyltransferase isoforms DNMT1 and DNMT3b2. The invention provides compounds and methods for inhibiting DNMT1 and DNMT3b2.
Owner:METHYLGENE

Nanosensor for detecting DNA methyltransferase based on single quantum dot

The invention discloses a nanosensor for detecting DNA methyltransferase based on a single quantum dot. The nanosensor only comprises a single detection probe thereby preventing complex detection design and cumbersome signal amplification steps. The nanosensor has high selectivity and high sensitivity to DNA methyltransferase. The nanosensor comprises a tail end 3'-biotinylated hairpin detection probe. The tail end 5' of the detection probe is labeled with a fluorophore cyanine 5(Cy5). The tail end 3' is labeled with a quenching group black hole quenching agent (BHQ2). The stem region contains a recognition sequence 5'-GATC-3' of a target DNA methyltransferase. The surface is coated with a streptavidin quantum dot. Through interaction of streptavidin and biotin, the probe is connected to the streptavidin-modified quantum dot surface so that a quantum dot / probe / cyanine 5 / black hole quenching agent complex is formed. The nanosensor also comprises a methylation-specific endonuclease (DpnI).
Owner:SHANDONG NORMAL UNIV

COMPOSITION FOR REPROGRAMMING SOMATIC CELLS TO GENERATE INDUCED PLURIPOTENT STEM CELLS, COMPRISING Bmi1 AND LOW MOLECULAR WEIGHT SUBSTANCE, AND METHOD FOR GENERATING INDUCED PLURIPOTENT STEM CELLS USING THE SAME

Provided is a composition for reprogramming somatic cells to generate embryonic stem cell-like cells, comprising: a) a Bmi1 (B cell-specific Moloney murine leukemia virus integration site 1) protein or a nucleic acid molecule encoding the Bmi1 protein; and b) at least one low molecular weight substance selected from the group consisting of a set of a MEK / ERK (mitogen-activated protein kinase / extracellular regulated kinase) inhibitor and a GSK (glycogen synthase kinase) inhibitor, a set of a G9a HMTase (G9a histone methyltransferase) inhibitor and a DMNT (DNA methyltransferase) inhibitor, and a histone deacetylase inhibitor. Also, a method is provided for reprogramming somatic cells to generate embryonic stem cell-like cells using the composition. In addition to reducing the number of the reprogramming factors conventionally needed, the composition and method allow the generation of pluripotent embryonic stem cell-like cells which have high potential in the cell therapy of various diseases.
Owner:STEMLAB

Taqman hydrolysis probe and method for quantitatively detecting methylation level of MGMT (O6-methylguanine-DNA-methyltransferase)

The invention provides a Taqman fluorescent hydrolysis probe and a method for quantitatively detecting the methylation level of MGMT (O6-methylguanine-DNA-methyltransferase) by using the Taqman hydrolysis probe. The fundamental sequence of the Taqman fluorescent hydrolysis probe is GATTTGGTGAGTGTUTGGG, and the complementary region of the fundamental sequence and a genomic DNA (deoxyribonucleic acid) sequence extends upstream no more than 5nt and extends downstream no more than 5nt. According to the invention, the specificity of PCR (polymerase chain reaction) is doubly guaranteed; the percent of a methylated DNA template in a mixed sample can be quantitatively calculated; and the method has all the advantages (such as speediness, sensitiveness, no pollution, and the like) of the real-time quantitative PCR. The application of detection results of the invention can provide clinical guide for medicaments for carrying out chemotherapy on malignant tumors such as cerebral gliomas and the like; and the method has the advantages of high specificity, high sensitivity, accurate quantification, and the like.
Owner:陕西佰美医学检验有限公司

Cyclopentathiophene/cyclohexathiophene DNA methyltransferase inhibitors

Compounds represented by Formula (I):are useful in treating diseases, such as cancer, that are mediated and / or associated (at least in part) with DNMT3b activity. The compounds can be formulated as pharmaceutically acceptable compositions for administration to a subject in need thereof.
Owner:VANKAYALAPATI HARIPRASAD +2

Reducing bacterial virulence

The virulence of bacterial strains and in particular pathogenic bacteria which infect human is reduced by an agent which alters the bacteria's native level or activity of DNA methyltransferase (Dam). The agent causes an alteration in the bacteria's native level of methylation of adenine in a GATC tetranucleotide which inhibits virulence of the bacteria. Thus, compounds and formulations thereof which reduce bacterial virulence inhibit proliferation of bacteria and are useful in treating bacterial infections, particularly in humans.
Owner:RGT UNIV OF CALIFORNIA

Composition and method for generating induced pluripotent stem cells using the same

The present invention relates to a composition and a method for generating induced pluripotent stem cells using the same Provided is a composition for reprogramming somatic cells to generate embryonic stem cell-like cells, comprising: a) a Bmi1 (B cell-specific Moloney murine leukemia virus integration site 1) protein or a nucleic acid molecule encoding the Bmi1 protein; and b) at least one low molecular weight substance selected from the group consisting of a set of a MEK / ERK (mitogen-activated protein kinase / extracellular regulated kinase) inhibitor and a GSK (glycogen synthase kinase) inhibitor, a set of a G9a HMTase (G9a histone methyltransferase) inhibitor and a DMNT (DNA methyltransferase) inhibitor, and a histone deacetylase inhibitor. Also, a method is provided for reprogramming somatic cells to generate embryonic stem cell-like cells using the composition.
Owner:STEMLAB

Kit and method for detecting activity of DNA methyltransferase

The invention discloses a method for detecting the activity of DNA methyltransferase based on single-ribonucleotide repair-mediated ligation-dependent cycling signal amplification. The method comprises the following steps: (1) adding a Dam MTase acted hairpin substrate to a resection reaction buffer solution, and carrying out a cleavage reaction to produce a 24-nt product; and (2) adding the cleavage product to an amplification reaction buffer solution, carrying out a cyclic linkage-dependent strand displacement amplification reaction to cyclically generate an enhanced fluorescent signal, anddetecting the intensity of the fluorescent signal to determine the activity of the Dam MTase. The method can effectively inhibit nonspecific amplification independent of a target and a template / primer, so the background signal is greatly reduced, and the index amplification of the signal is finally achieved. The method has a high sensitivity and a high specificity, and the lower detection limit can reach 4.8 * 10<-6> U / mL.
Owner:SHANDONG NORMAL UNIV

Method of treating a cancer

InactiveUS20060115829A1Restores expressionRapid demethylationVirusesSugar derivativesCancer preventionTumour suppressor gene
The present invention provides isolated nucleic acids encoding delta DNA methyltransferase 3B molecules that are involved in the treatment and prevention of cancers such as, but not limited to, lung cancer. The delta DNA methyltransferase 3B molecules of the present invention are found to play a critical role in promoter-specific methylation of tumor suppressor genes. The DNA methyltransferase 3B molecules of the present invention are provided as therapeutic targets for identifying inhibitors of DNA methyltransferase. Such inhibitors are contemplated for the treatment and / or prevention of cancers. In particular embodiments, the present invention involves the treatment and prevention of a non-small cell lung cancer.
Owner:BOARD OF RGT THE UNIV OF TEXAS SYST

Fluorescence real-time quantitative PCR (Polymerase Chain Reaction) detection method of micropterus salmoides ulcer syndrome viruses

The invention provides a fluorescence real-time quantitative PCR (Polymerase Chain Reaction) detection method of micropterus salmoides ulcer syndrome viruses, comprising the following steps of: designing and synthesizing primers according to noncoding region sequences of DNA methyltransferase 3' sides of the micropterus salmoides ulcer syndrome viruses, previously amplifying 167 bp snippets: an upstream primer PF: 5'-GCTCGTTCGGTTGTGCTGAC-3', a downstream primer PR: 5'-GTGTCTCCCTGGTAGTCTTTCAAAC-3'; also synthesizing a probe PB: 5'-(FAM)ATCTGTGTAACCGCCCGCCGCAAAG(Eclipse)-3' used for fluorescence detection; and judging the content of virus particles contained in a sample according to detected CT (Computed Tomography) value through template DNA extraction and PCR amplified reaction. The invention has the advantages of fast detection and high detection accuracy.
Owner:PEARL RIVER FISHERY RES INST CHINESE ACAD OF FISHERY SCI

Small molecule compound combination and method for preparing vascular endothelial cells by using small molecule compound combination to induce differentiated cells

The invention discloses a small molecule compound combination and a method for preparing vascular endothelial cells by using the small molecule compound combination to induce differentiated cells. According to the method, differentiated cells are subjected to targeted induction so as to finally obtain vascular endothelial cells, wherein the targeted induction comprises: inhibiting the activity oflysine deacetylase activity, inhibiting the signaling pathway of TGF-beta, inhibiting the activity of DNA methyltransferase (DNMT), activating the signaling pathway of WNT / beta-catenin, and activatingthe signaling pathway of cAMP. According to the present invention, through the induction with the small molecule compound combination, the differentiated cells can be transdifferentiated into the vascular endothelial cells, each step can be subjected to precise quality control, and the standardized operation and the large-scale production can be conveniently achieved; and the donor source of themethod is wide, the patient himself can be served as the donor, and the vascular endothelial cells required by basic research, clinical treatment or tissue engineering production can be obtained within a short time.
Owner:深圳臻德济慈药品研发有限公司

Combination of epigenetic factors and bispecific compounds targeting CD33 and CD3 in the treatment of myeloid leukemia

The present invention provides a combination epigenetic factors and bispecific compounds targeting CD33 and CD3 in the treatment of myeloid leukemia, wherein the epigenetic factor is selected from thegroup consisting of histone deacetylase (HDAC) inhibitors, DNA methyltransferase (DNMT) I inhibitors,hydroxyurea, Granulocyte-Colony Stimulating Factor (G-CSF), histone demethylase inhibitors and ATRA (All Trans-retinoic acid). Accordingly, the invention provides a pharmaceutical composition comprising a CD33 targeting compound and at least one epigenetic factor and an epigenetic factor for use in the amelioration and / or treatment of a myeloid leukemia, wherein the epigenetic factor increases the responsiveness of a patient to a CD33 targeting compound. Moreover, the invention provides the use of at least one an epigenetic factor for increasing the responsiveness of a myeloid leukemia patient to a treatment with a CD33 targeting compound, a method for the treatment of a myeloid leukemia,the method comprising the administration of at least one epigenetic factor and a CD33 targeting compound to a patient in the need thereof and a kit comprising a pharmaceutical composition of the invention or an epigenetic factor of the invention and a bispecific CD33 targeting compound.
Owner:AMGEN INC +1

Sensor based on TdT-RCA and application thereof in DNA methyltransferase detection

The invention provides a sensor based on TdT-RCA and application thereof in DNA methyltransferase detection, the sensor comprises a Dam methyltransferase detection probe and a dumbbell-shaped rollingring template. According to the sensor based on TdT-RCA and application thereof in DNA methyltransferase detection, the non-specific amplification of terminal transferase (TdT) activation is effectively prevented by carrying out amination modification on the 3' end of a substrate hairpin probe acting on methyltransferase, so that a background signal is reduced, and the specificity of the detectionmethod is greatly improved; the primer extension catalyzed by TdT is combined with a dumbbell-shaped template-mediated rolling circle amplification (RCA) reaction, thionein T (ThT) is taken as fluorescent dye (thionein T is specifically combined with a reaction product G triple chain as a signal output), the fluorescent label is not needed, the operation is simple, and the experimental cost is reduced; the method can better distinguish the Dam methyltransferase from other methyltransferase and has better selectivity.
Owner:CHONGQING MEDICAL UNIVERSITY

Novel function of karounitriol on reducing expression level of DNA transmethylase

karounitriol is an important active ingredient from traditional Chinese medicine material semen trichosanthis. The invention discloses a novel function of karounitriol. It is found through experiments of the action of semen trichosanthis glycol on rat primary culture nerve cells that the expression level of DNMT1 genes can be reduced by addition of karounitriol. DNMT1 is the key enzyme causing DNA methylation which is an important constituent part of epigenetics, changes of DNA methylation represent that the nervous system makes a global stress reaction on karounitriol, and it is shown that karounitriol has a significant regulating effect on activities of the nervous system.
Owner:浙江高美生物科技有限公司

New compounds

InactiveUS20140357594A1Reduction in rate of progressHalt in rate of progressBiocideSugar derivativesArylDisease
This invention relates to heteroaryl compounds, containing a purinyl moiety, that inhibit DNA methyltransferase (DNMT) activity—including DNMT1, DNMT3a, or DNMT3b—useful in the treatment of cancer and hyperproliferative diseases.
Owner:GLAXOSMITHKLINE INTELLECTUAL PROPERTY (NO 2) LTD

Monocloned antibody of O6-methylguanine-DNA methyltransferase preparation process and test kit

The present invention relates to a monoclonal antibody of specific conjugated O6-methylguanine-DNA methyltransferase KRTTLDSPLGKLE(C) sequence and hybridoma cell line CGMCC 0827 capable of secreting said monoclonal antibody. Said invention also relates to the method for preparing said monoclonal antibody and the application of the described monoclonal antibody in preparation of horizontal detection kit for identifying O6-methylguarine-DNA methyltransferase in the sample. Said invention also relates to the method for utilizing said kit.
Owner:FIELD OPERATION BLOOD TRANSFUSION INST OF PLA SCI ACAD OF MILITARY

Novel compounds as dual inhibitors of histone methyltransferases and DNA methyltransferases

It relates to the use of compounds of formula (I′), or their pharmaceutically or veterinary acceptable salts, or their stereoisomers or mixtures thereof, as anticancer agents and as agents for generating induced pluripotent stem cells. Compounds of formula (I′), wherein R2′ is an alcoxy group, a hydrocarbon chain or a ring system, and R1, R3, and R4 are as defined herein, are dual inhibitors of histone methyltransferases and DNA methyltransferases. It also relates to the compounds of formula (I′), or their pharmaceutically or veterinary acceptable salts, or their stereoisomers or mixtures thereof, wherein R2′ is phenyl or 5- to 6-membered heteroaromatic ring, both optionally fused to another rings (i.e., compounds of formula (I)). It also relates to pharmaceutical or veterinary compositions containing compounds of formula (I).
Owner:FUNDACION PARA LA INVESTIGACION MEDICA APLICADA

Expression vector for targeted inhibition of HIV-1 provirus expression as well as preparation method and application of expression vector

The invention belongs to the field of gene therapy and relates to preparation and an application of an expression vector for targeted inhibition of HIV-1 provirus expression by use of embedded DNA methyltransferase adopting a zinc finger structure. The expression vector carrying the DNA methyltransferase adopting the zinc finger structure is proved to be able to inhibit silence of HIV-1 provirus expression in HIV-1 infection and latent infection cell models, the vector can effectively inhibit virus replication in virus infected cells and latent infected cells for 15-40 days or above. Besides,provirus expression silence caused by the expression vector carrying the embedded methyltransferase adopting the zinc finger structure can be inhered among cell generations and has certain safety in cells. A new idea is provided for curing AIDS.
Owner:FUDAN UNIV

Method for detecting activity of O6-methylguanine-DNA (Deoxyribose Necleic Acid) methyltransferase

The invention discloses a method for detecting the activity of O6-methylguanine-DNA (Deoxyribose Necleic Acid) methyltransferase. The method is that the activity of O6-methylguanine-DNA (Deoxyribose Necleic Acid) methyltransferase is detected by adopting a bioluminescence resonance energy transfer technology and a chemiluminescence technology for the first time, and comprises the steps of incubating streptavidin-luciferase fusion protein and O6-methylguanine-DNA methyltransferase labeled by biotin for 30-60 minutes at the temperature of 0-40 DEG C, then adding O6-methylguanine-DNA methyltransferase antibody labeled by fluorochrome, incubating for 30-60 minutes at the temperature of 0-40 DEG C, then adding a fluorescein substrate, standing for 5-30 minutes at the temperature of 4-30 DEG C, detecting the lighting intensity at the position of 670nm, and further calculating to obtain the activity of O6-methylguanine-DNA methyltransferase. According to the method disclosed by the invention, the operation is simple and convenient, the applicable range is wide, the scattering caused by exogenous exciting light and the interference of backgrounds such as sample matrix fluorescence can be avoided, and the sensitivity and the accuracy are high.
Owner:HANGZHOU NORMAL UNIVERSITY

DNA methyltransferases for the treatment and prevention of arthritis

ActiveUS20170071889A1Reduce cartilage degradationHigh expressionOrganic active ingredientsEnzymesArthritisAminobutyrate Aminotransferase
The present disclosure is directed to compositions and methods for treating osteoarthritis comprising increasing the expression of Dnmt3b and / or inhibiting aminobutyrate aminotransferase.
Owner:WASHINGTON UNIV IN SAINT LOUIS

Analysis of methylation sites

InactiveUS20130130922A1Low levelEfficient labeling and separationSugar derivativesMicrobiological testing/measurementModified dnaGenomic DNA
A method for labeling unmethylated CpG dinucleotides within a DNA fragment, and use of the method in profiling of genomic DNA methylation. The present invention further provides modified DNA methyltransferase enzymes and compounds which are capable of being used by the enzymes as cofactors for use in the labeling method.
Owner:VILNIUS UNIV +1
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Eureka Blog
Learn More
PatSnap group products