Patents
Literature
Hiro is an intelligent assistant for R&D personnel, combined with Patent DNA, to facilitate innovative research.
Hiro

32 results about "Feline infectious peritonitis" patented technology

Feline infectious peritonitis (FIP) is the name given to an uncommon, but usually fatal, aberrant immune response to infection with feline coronavirus (FCoV).

Nucleoside compound and application thereof in treatment of feline infectious peritonitis

The invention relates to a nucleoside compound and application of the nucleoside compound in treatment of feline infectious peritonitis. The compound belongs to a GS-441524 analogue. The compound has a very small toxic effect on normal cells of cats, and has an obvious inhibition effect on feline coronavirus. The compound can be used for preparing a feline coronavirus inhibitor, is used for treating feline infectious peritonitis, has the advantages of good curative effect, high safety and the like, and is very good in water solubility and easier to absorb.
Owner:SUZHOU VIGONVITA LIFE SCIENCES CO LTD

Method for quickly detecting Chinese papaya leaf curl virus by LAMP (loop mediated isothermal amplification)

The invention provides a method for quickly detecting Chinese papaya leaf curl virus by LAMP (loop mediated isothermal amplification), belonging to the field of plant protection. The method comprises the following steps of: designing an LAMP primer (P-F3, P-B3, P-FIP (feline infectious peritonitis) and P-BIP (bit interleaved parity)) according to the nucleotide sequence of the Chinese papaya leaf curl virus; performing the LAMP reaction after total DNA (deoxyribonucleic acid) is extracted from a sample; and performing the electrophoresis or the fluorescent dye to a reaction product. The method is simple to operate, some special apparatuses such as a PCR apparatus and the like are avoided, and the problems of the conventional methods such as the biology, the serology and the like are overcome, so that the detection method is simple, fast, sensitive and economical.
Owner:JIANGSU ACADEMY OF AGRICULTURAL SCIENCES

Feline infectious peritonitis virus inhibitor composition composed of GC376 and GS-441524

The invention discloses a feline infectious peritonitis virus inhibitor composition. The feline infectious peritonitis virus inhibitor composition is composed of GC376 and GS-441524. As is shown by results of in-vitro cell experiments, through combined drug application of the GC376 and GS-441524, the proliferation of feline infectious peritonitis viruses in cells can be inhibited, and the effect of combined drug application is obviously better than that of separate drug application; meanwhile, a great inhibition effect can be achieved with a low dose, the synergistic interaction effect is obvious, and the composition can be used as a feline infectious peritonitis virus inhibitor, is used for treating feline infectious peritonitis, and has the advantages that the curative effect is good, the safety is high, the drug resistance of the viruses is lowered, and the toxic and side effects of the drug are lowered.
Owner:HUAZHONG AGRI UNIV

Feline infectious peritonitis vaccine

The invention comprises the nucleotide sequences comprising the FIPV S gene, or a fragment of this gene, which are modified in at least one of the antigenic regions A1 and A2 which are involved in enhancement, as well as the use of these sequences for the expression of modified proteins, and for the construction of recombinant viruses or expression plasmids, and the use of the recombinant viruses as vaccines against feline infectious peritonitis, the use of the expression plasmids as immunizing composition by direct injection of the said plasmids into cats, and the use of the modified proteins as vaccine.
Owner:MERIAL SAS

Vaccine for feline infectious peritonitis

FIP vaccines were provided that use an N protein with a specific structure, or a fragment thereof, as an antigen. Preferred antigens of this invention are N proteins derived from a specific type I virus strain (KU-2). Vaccines comprising such an N protein confer preventive effects against a wide range of FIPVs. In addition, the N proteins are very safe because they do not comprise epitopes that enhance infection. Furthermore, preventive effects can be accomplished against type I viruses, which actually cause 70% or more of FIP.
Owner:KITASATO DAIICHI SANKYO VACCINE

Methods and compositions in the treatment of coronaviruses

The invention relates generally to the field of virology, and relates to the identification and characterization of the targets involved in the evasion strategy of viruses and to the use thereof in methods to identify anti-viral compounds. More in particular to identify compounds which are modulators of myosin light chain kinase (MLCK), a target within said entry and immune-evasion strategy. Other aspects of the invention are directed to anti-viral compounds identified using the models and methods of the present invention, as well as to the use thereof in treating viral infections, such as for example caused by the feline infectious peritonitis virus (FIPV), a coronavirus which belongs to an antigenic group which comprises in particular feline enteric coronavirus (FECV), canine coronavirus (CCV), swine transmissible gastroenteritis coronavirus (TGEV), porcine respiratory coronavirus (PRCV) and human coronavirus (HCV), and which induces, in a host-dependent manner, a range of symptoms which range from mild enteritis to the severe debilitating disease, and, in some cases, up to death. In a particular aspect the present invention provides the use of MLCK inhibitors for the treatment of feline infectious peritonitis (FIP).
Owner:UNIV GENT

Kit for simultaneously detecting multiple cat pathogens as well as detection method and application of kit

The invention discloses a kit for simultaneously detecting multiple cat pathogens as well as a detection method and application of the kit. A specific primer group and a probe group are obtained through design, so that rapid and accurate detection and identification on feline plague viruses, feline calicivirus, feline infectious peritonitis viruses, feline toxoplasma gondii, feline herpes viruses, feline chlamydia and feline mycoplasma in one reaction are realized at the same time. The detection kit obtained on the basis of the design is high in specificity and sensitivity, the feline pathogens with the concentration of 1.7 * 10 <2> copies / mL can be effectively detected, repeated detection is not needed, the actual application accuracy is high, and the detection kit can be widely applied to epidemic situation monitoring, prevention and control of feline virus infection.
Owner:广州蔚捷生物医药科技有限公司

Application of FHPI for preparing medicine for treatingcfeline infectious peritonitis

The invention discloses application of FHPI for preparing a medicine for treating feline infectious peritonitis. FHPI has the little toxic effect on normal feline cells, has the obvious inhibition effect on feline coronaviruses, and can obviously lower the virulence of viruses in cells; indirect immunofluorescence light and Western Blot determination results show that FHPI can inhibit proliferation of feline coronaviruses in cells, and has the dose dependence. Accordingly, the FHPI has the activity for resisting feline coronaviruses, can be used for preparing a feline coronavirus inhibitor, can be used for treating feline infectious peritonitis and has the advantages of being good in curative effect, high in safety and the like.
Owner:HUAZHONG AGRI UNIV +1

Reagent kid for quantitatively testing mRNA (messenger ribonucleic acid) level of FIP1L1-PDGFRA (feline infectious peritonitis 1 like 1-platelet-derived growth factor receptor alpha) fusion genes

InactiveCN102827935AGuaranteed specific amplificationAccurately reflect tumor burdenMicrobiological testing/measurementFluorescence/phosphorescenceFip1l1 pdgfraPlatelet-Derived Growth Factor Receptor Alpha
The invention discloses a reagent kit for quantitatively testing mRNA (messenger ribonucleic acid) level of FIP1L1-PDGFRA (feline infectious peritonitis 1 like 1-platelet-derived growth factor receptor alpha) fusion genes. The test reagent contains upstream primers I, downstream primers I and TaqMan probes I which are used for real-time quantitative PCR (polymerase chain reaction) testing for mRNA of the FIP1L1-PDGFRA fusion genes. The upstream primers I include at least one of single-chain DNA (deoxyribose nucleic acid) shown as sequences 1, 2, 3, 4 and 5 in a sequence table, the downstream primers I include at least one of two single-chain DNA as shown in sequence 9 and 10 in the sequence table, and the TaqMan probes I include at least one of two single-chain DNA as shown in sequences 9 and 10 in the sequence table. The reagent kit has the advantages of speediness, simplicity, convenience and the like in testing, common types of FIP1L1-PDGFRA fusion genes can be covered in one experiment, and the mRNA level of the FIP1L1-PDGFRA fusion genes can be tested. The reagent kit can be used for FIP1L1-PDGFRA fusion gene screening and therapeutic evaluation for eosinophilia patients, and further can be used for monitoring minimal residual diseases.
Owner:PEOPLES HOSPITAL PEKING UNIV

RT-RPA primer pair, probe, kit and detection method for detecting cat coronavirus

The invention provides an RT-RPA primer pair, a probe, a kit and a detection method for detecting cat coronavirus, and belongs to the technical field of molecular biological detection. Aiming at an MPgene sequence of a cat coronavirus feline infectious peritonitis viruses (Fcov), a specific primer pair and a probe are designed, and a real-time fluorescence RPA detection method is established through repeated tests. The method disclosed by the invention is strong in amplification specificity and high in sensitivity, and can be used for detecting two viruses of FCoV-I and FCoV-II serotypes which both can cause feline infectious peritonitis (FIP) in one detection test, so that the method is more efficient. Technical reference is provided for rapid diagnosis and prevention and control of Fcov.
Owner:GUANGDONG LAB ANIMALS MONITORING INST +1

Feline infectious peritonitis vaccine

The invention comprises the nucleotide sequences comprising the FIPV S gene, or a fragment of this gene, which are modified in at least one of the antigenic regions A1 and A2 which are involved in enhancement, as well as the use of these sequences for the expression of modified proteins, and for the construction of recombinant viruses or expression plasmids, and the use of the recombinant viruses as vaccines against feline infectious peritonitis, the use of the expression plasmids as immunizing composition by direct injection of the said plasmids into cats, and the use of the modified proteins as vaccine.
Owner:MERIAL SAS

HRM primer pair, kit and method for rapidly identifying feline enteric coronavirus and feline infectious peritonitis viruses

The invention provides an HRM primer pair, kit and method for rapidly identifying feline enteric coronavirus and feline infectious peritonitis viruses, and belongs to the technical field of molecularbiological detection. The high-resolution melting (HRM) primer pair disclosed by the invention is designed according to a sequence between 29000bp and 29500bp of a full-length gene of feline coronavirus (FCOV). The feline enteric coronavirus (FECV) and the feline infectious peritonitis viruses (FIPV) can be identified and distinguished at the same time through melting curves with different shapesby one-time reaction, and technical support is provided for early diagnosis and prevention and control of diseases.
Owner:GUANGDONG LAB ANIMALS MONITORING INST

Application of compound in prevention and/or treatment of pathogen infection of animals

The invention discloses application of a compound in preventing and / or treating pathogen infection of animals. The compound is 4-(3-{2-amino-5-[2-(1-methyl-piperidin-4-yl)-thiazole-5-yl]-pyridine-3-yloxymethyl}-phenyl)-2-methylbutyl-3-alkyn-2-ol, and the structure of the compound is as shown in the following formula I in the specification. The compound can be used for effectively treating diseases (such as feline infectious peritonitis) caused by animal pathogen (especially virus such as coronavirus) infection and improving the survival condition of animals, and has better commercial value and application prospect in the field of veterinary anti-pathogen (especially virus such as coronavirus) medicines.
Owner:GARGAMEL(ZHUHAI) BIOTECH LTD

Traditional Chinese medicine composition for treating feline infectious peritonitis

The invention provides a traditional Chinese medicine composition for treating feline infectious peritonitis, which comprises the following traditional Chinese medicine components: radix puerariae, Snphora angustifolia, radix scutellariae, Herba Lycopi, dandelion, radix bupleuri, milk veteh, and radix codonopsitis. According to the method of Chinese veterinary medicine dialectical therapy, radix puerariae has the effects of releasing the exterior and relieving the muscles and skin, removing fever and promoting eruption, promoting the production of body fluid to quench thirst, lifting yang and relieving diarrhea; Snphora angustifolia has the effects of clearing heat and drying damp, dispersing pathogenic wind, killing parasites to relieve itching and promoting urination; radix scutellariae has the effects of clearing heat and drying damp, purging intense heat and detonicating; Herba Lycopi has the effects of promoting blood circulation by removing blood stasis and inducing diuresis for removing edema; dandelion has the effects of clearing away heat and toxic material and removing swelling and stasis; radix bupleuri has the effects of expelling surficial evils and heat-evil, soothing liver-qi stagnation and lifting yang; milk veteh has the effects of invigorating qi for securing the exterior, draining water and reducing swelling, draining pus and expelling toxin and promoting tissue regeneration; and radix codonopsitis has the effects of tonifying middle-Jiao and Qi, strengthening the spleen and replenishing lung. According to combined action of radix puerariae, Snphora angustifolia, radix scutellariae, Herba Lycopi, dandelion, radix bupleuri, milk veteh, and radix codonopsiti, feline infectious peritonitis can be efficiently treated.
Owner:TIANJIN JIHE TECH

Novel method for diagnosing feline infectious peritonitis

The invention discloses a novel method for diagnosing feline infectious peritonitis. A kit adopted in the method comprises a primer shown as SEQ ID NO.1-2 and two amino acid differences shown as SEQ ID NO.3-4. The invention further provides a new thought for identifying feline infectious peritonitis (FIPV) and feline enteric corona virus (FECV). By means of the detection scheme, accurate, specificand sensitive result judgment which cannot be completed through an existing detection technology can be achieved, the detection accuracy on feline infectious peritonitis is remarkably improved, and important technical support is provided for discovering and effectively preventing and controlling feline infectious peritonitis as soon as possible.
Owner:武汉康湃特生物科技有限公司

Method for prophylaxis or treatment of feline infectious peritonitis

Provided is a method for treatment and / or prophylaxis of FIP (feline infectious peritonitis) in cats. The method is performed by administering to a cat a composition comprising a therapeutic and / or prophylactic amount of a cysteine protease inhibitor. The cysteine protease inhibitor can be a selective cathepsin B inhibitor. Also provided is a method for inhibiting FIPV (Feline infectious peritonitis virus) replication. The method comprises contacting a cell infected with FIPV with a cysteine protease inhibitor in an amount effective to inhibit replication of FIPV. It is expected the method will be effective for therapy or prophylaxis of FIP in any species of cat and will be effective against any strain of feline coronavirus.
Owner:CORNELL UNIVERSITY

Primers for cat coronavirus gene amplification and genotyping method

The invention relates to a cat coronavirus gene amplification primer and a genotyping method. The primer is a cat coronavirus S gene primer, and a high-resolution melting curve (HRM) identification method of an SNP site (g.23531A>Y) on a cat coronavirus fibrin gene S can be established by applying the primer. A detection method established by applying the primer can be used for rapidly detecting and identifying the genotype of the 23531st site of the cat coronavirus genome from a pet clinical sample; and thus, and then the systemic infectivity phenotype of the corresponding strain can be deduced, so that the primer can be used as a basis for screening pathogenicity of the cat coronavirus, and can also be used as an important reference for clinical diagnosis of infectious peritonitis of cats.
Owner:LUDONG UNIVERSITY +1

Application of bromophenol-pyrazoline compound in treatment of feline coronavirus diseases

The invention belongs to the technical field of medicines, and particularly relates to application of a bromophenol-pyrazoline compound in treatment of feline coronavirus diseases. The research finds that the bromophenol-pyrazoline compound can inhibit the activity of feline infectious peritonitis virus main protease (FIPV Mpro) and interfere replication of Feline Infectious Peritonitis Virus (FIPV) in cells. In clinical experiments, the bromophenol-pyrazoline compound can treat feline infectious peritonitis naturally infected by the FIPV, greatly improves the survival rate of sick cats, and can be used for preparing medicines for treating the feline infectious peritonitis.
Owner:SHANDONG LINGHAI BIOTECHNOLOGY CO LTD

Egg yolk antibody composition for cat infectious peritonitis as well as preparation method and application of egg yolk antibody composition

ActiveCN114835804AEffective treatment of feline infectious peritonitisGood effectEgg immunoglobulinsSsRNA viruses positive-senseEnteric coronavirus infectionCross infections
The invention belongs to the technical field of gene recombination and antibody preparation, and particularly discloses a cat infectious peritonitis egg yolk antibody composition as well as a preparation method and application thereof. The composition is obtained by mixing a feline intestinal coronavirus S protein egg yolk antibody, a type I feline infectious peritonitis virus S protein egg yolk antibody and a type II feline infectious peritonitis virus S protein egg yolk antibody according to the mass ratio of (1-2): (1-2): (1-2) under the same titer, and compared with a single antibody, the two antibodies are mixed to form the composition. And the three antibodies are mixed according to other proportions, so that the effect of treating feline infectious peritonitis is good. The traditional Chinese medicine composition not only can neutralize cat intestinal coronavirus infection without clinical symptoms so as to prevent cat infectious peritonitis virus infection, but also can neutralize infection of cat infectious peritonitis type I and type II with clinical symptoms so as to achieve the effect of treating cat infectious peritonitis. And particularly, the compound has a relatively good treatment effect on cross infection of type I and type II cat infectious peritonitis viruses.
Owner:安徽中起生物科技有限公司

Methods for reducing the internalization of viruses and identification of compounds effective thereof

The invention relates generally to the field of virology, and relates to the identification and characterization of the targets involved in the evasion strategy of viruses and to the use thereof in methods to identify anti-viral compounds. More in particular to identify compounds which are modulators of myosin light chain kinase (MLCK), a target within said entry and immune-evasion strategy. Other aspects of the invention are directed to anti-viral compounds identified using the models and methods of the present invention, as well as to the use thereof in treating viral infections, such as for example caused by the feline infectious peritonitis virus (FIPV), a coronavirus which belongs to an antigenic group which comprises in particular feline enteric coronavirus (FECV), canine coronavirus (CCV), swine transmissible gastroenteritis coronavirus (TGEV), porcine respiratory coronavirus (PRCV) and human coronavirus (HCV), and which induces, in a host-dependent manner, a range of symptoms which range from mild enteritis to the severe debilitating disease, and, in some cases, up to death. In a particular aspect the present invention provides the use of MLCK inhibitors for the treatment of feline infectious peritonitis (FIP).
Owner:UNIV GENT

Fluorescent quantitative RT-PCR detection kit for feline infectious peritonitis virus

The invention relates to a fluorescent quantitative RT-PCR (Reverse Transcription-Polymerase Chain Reaction) detection kit for a feline infectious peritonitis virus. The kit comprises a specific primer for fluorescent quantitative RT-PCR detection of the feline infectious peritonitis virus and a TaqMan probe, wherein the sequence of the forward primer is SEQ ID NO: 2, and the sequence of the reverse primer is SEQ ID NO: 3; the sequence of the TaqMan probe is as shown in SEQ ID NO: 4. The kit has good sensitivity, specificity and stability, is suitable for rapid diagnosis in the early stage of feline infectious peritonitis virus infection, and has important significance for reducing the transmission of feline infectious peritonitis and improving the detection efficiency of feline infectious peritonitis.
Owner:昆明海关技术中心

Conditioning paste for treating cat abdominal infection and preparation method of conditioning paste

The invention discloses conditioning paste for treating cat abdominal infection and a preparation method of the conditioning paste. The conditioning paste is prepared from the following components: Chinese herbaceous peony, raw liquorice, codonopsis pilosula, bighead atractylodes rhizome, pericarpium citri reticulatae, cortex moutan, salvia miltiorrhiza, red paeony root, radix bupleuri, patrinia, selfheal, dandelion, Chinese waxgourd seed, honeysuckle, radix stemonae and ginger. The feline infectious peritonitis is a chronic, progressive and lethal infectious disease caused by feline infectious peritonitis virus, has the main characteristics of peritonitis, accumulation of a large amount of ascites and high fatality rate, and has the external symptoms of stomachache, nausea and vomiting, fever, unclear recognition and the like. According to the invention, the Chinese herbaceous peony and the raw licorice are used as monarch drugs for nourishing liver, relieving spasm and pain, clearing heat and detoxifying. Codonopsis pilosula, atractylodes macrocephala koidz and pericarpium citri reticulatae are adopted to promote transportation and transformation of spleen and stomach of pets and enhance autoimmunity, radix stemonae and ginger are adopted to kill insects and bacteria, and the death rate of infected cats on the abdomen is reduced by adopting prevention and conditioning principles.
Owner:深圳市旺金生物科技有限公司

Use of HPK1 kinase inhibitors for prevention and/or treatment of pathogen infections in animals

The invention discloses an application of an HPK1 kinase inhibitor in preventing and / or treating pathogen infection of animals. The HPK1 kinase inhibitor is a small-molecule HPK1 kinase inhibitor, in particular a compound shown in a general formula I or pharmaceutically acceptable salt, stereoisomer, ester, prodrug, solvate or deuterated compound thereof. The HPK1 kinase inhibitor can be used for effectively treating diseases (such as feline infectious peritonitis) caused by animal pathogen (especially virus such as coronavirus) infection and improving the survival condition of animals, and has better commercial value and application prospect in the field of veterinary antiviral (especially virus such as coronavirus) medicines.
Owner:ZHUHAI YUFAN BIOTECHNOLOGIES CO LTD

Reagent kid for quantitatively testing mRNA (messenger ribonucleic acid) level of FIP1L1-PDGFRA (feline infectious peritonitis 1 like 1-platelet-derived growth factor receptor alpha) fusion genes

InactiveCN102827935BGuaranteed specific amplificationAccurately reflect tumor burdenMicrobiological testing/measurementDeoxyriboseInfectious peritonitis
The invention discloses a reagent kit for quantitatively testing mRNA (messenger ribonucleic acid) level of FIP1L1-PDGFRA (feline infectious peritonitis 1 like 1-platelet-derived growth factor receptor alpha) fusion genes. The test reagent contains upstream primers I, downstream primers I and TaqMan probes I which are used for real-time quantitative PCR (polymerase chain reaction) testing for mRNA of the FIP1L1-PDGFRA fusion genes. The upstream primers I include at least one of single-chain DNA (deoxyribose nucleic acid) shown as sequences 1, 2, 3, 4 and 5 in a sequence table, the downstream primers I include at least one of two single-chain DNA as shown in sequence 9 and 10 in the sequence table, and the TaqMan probes I include at least one of two single-chain DNA as shown in sequences 9 and 10 in the sequence table. The reagent kit has the advantages of speediness, simplicity, convenience and the like in testing, common types of FIP1L1-PDGFRA fusion genes can be covered in one experiment, and the mRNA level of the FIP1L1-PDGFRA fusion genes can be tested. The reagent kit can be used for FIP1L1-PDGFRA fusion gene screening and therapeutic evaluation for eosinophilia patients, and further can be used for monitoring minimal residual diseases.
Owner:PEOPLES HOSPITAL PEKING UNIV

Application of conivaptan hydrochloride in preparation of medicine for treating feline infectious peritonitis

The invention discloses use of conivaptan hydrochloride in the preparation of a drug for treating feline infectious peritonitis. Conivaptan hydrochloride has very low toxicity to feline normal cells and has an obvious inhibition effect to feline coronavirus and is capable of obviously reducing virulence of viruses in the cells; an indirect immunofluorescence detection result shows that conivaptanhydrochloride can effectively inhibit the proliferation of the feline coronavirus in the cells and has dose dependence. Therefore, conivaptan hydrochloride can be used for preparing a feline coronavirus inhibitor for treating feline infectious peritonitis and has the advantages of good treatment effect, high safety and the like.
Owner:武汉都为康生物科技有限公司

Nucleoside compound and application thereof in treating feline infectious peritonitis

The invention relates to a nucleoside compound and application of the nucleoside compound in treatment of feline infectious peritonitis. The compound belongs to a GS-441524 analogue. The compound has a very small toxic effect on normal cells of cats, and has an obvious inhibition effect on feline coronavirus. The compound can be used for preparing a feline coronavirus inhibitor, is used for treating feline infectious peritonitis, has the advantages of good curative effect, high safety and the like, and is very good in water solubility and easier to absorb.
Owner:SUZHOU VIGONVITA LIFE SCIENCES CO LTD

Special primer capable of quickly detecting human coronavirus NL63 as well as kit and application method thereof

The invention discloses a special primer capable of quickly detecting human coronavirus NL63 as well as a kit and an application method thereof. The special primer consists of six primers, which are respectively F3, FIP (Feline Infectious Peritonitis), BIP (Binding Ig Protein), B3, LF (Lactoferrin) and LB (Liquid-Phase Basicity), wherein the F3 and the B3 are two outer primers, the FIP is an inner primer consisting of the F1 and the F2 and an inner primer BIP consisting of the B1 and the B2, and the LF and the BF are two annular primers; a nucleotide sequence is as representn below: CATTTTACATGCCTCTTTTGGB3; CCTTATGAGGTCCAGTACCFIP; TCCAATAACCAATCTGCTCATCTTTTGATAAGGCACCATATAGGGTBIP; GTTCAAGAGCGTTGGCGTATAAAATGAACTTTAGGAGGCAAATLF; GGGACAAGATTCCTGGGAATGBF; CAGGGGGCAACGTGTTG.
Owner:江苏国际旅行卫生保健中心无锡分中心

Application of fhpi in preparation of medicine for treating cat infectious peritonitis

The invention discloses a new application of FHPI in treating feline infectious peritonitis. FHPI has little toxic effect on cat normal cells, but has obvious inhibitory effect on feline coronavirus, and can significantly reduce the toxicity of the virus in cells; the results of indirect immunofluorescence and Western Blot assays show that FHPI can inhibit feline coronavirus Proliferation in cells was dose-dependent. Therefore, FHPI has anti-feline coronavirus activity, can be used to prepare feline coronavirus inhibitors, and is used for treating feline infectious peritonitis, and has the advantages of good curative effect and high safety.
Owner:HUAZHONG AGRI UNIV +1
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More