Patents
Literature
Hiro is an intelligent assistant for R&D personnel, combined with Patent DNA, to facilitate innovative research.
Hiro

198 results about "Deoxynupharidine" patented technology

Anti-Ctla-4 Antibody and Cpg-Motif-Containing Synthetic Oligodeoxynucleotide Combination Therapy for Cancer Treatment

InactiveUS20090117132A1Improve immune activityReducing cytotoxic side effectAntibody ingredientsAntineoplastic agentsThird-line therapyPhases of clinical research
The invention relates to administration of an anti-CTLA-4 antibody, particularly human antibodies to human CTLA-4, such as those having amino acid sequences of antibodies 3.1.1, 4.1.1, 4.8.1, 4.10.2, 4.13.1, 4.14.3, 6.1.1, 11.2.1, 11.6.1, 11.7.1, 12.3.1.1, 12.9.1.1, and MDX-010, in combination with an immunostimulatory nucleotide, i.e, CpG ODN PF3512676, for treatment of cancer. The invention relates to administering a combination of an anti-CTLA-4 antibody and CpG ODN PF3512676 as neoadjuvant, adjuvant, first-line, second-line, and third-line therapy of cancer, whether localized or metastasized, and at any point(s) along the disease continuum (e.g, at any stage of the cancer).
Owner:PFIZER INC +1

Methods of copying the methylation pattern of DNA during isothermal amplification and microarrays

A method for copying the methylation patterns of molecules of genomic DNA (MGD) during isothermal amplification of the MGD comprising obtaining MGD, copying the methylation patterns of the MGD using a DNA methylation-maintenance enzyme, while isothermally amplifying the MGD using a DNA polymerase with strand displacement activity, under conditions that simultaneously promote activity of the DNA methylation-maintenance enzyme and the DNA polymerase; a method for copying the methylation patterns in double-stranded DNA molecules during isothermal amplification of the DNA molecules comprising obtaining DNA molecules, contacting the DNA molecules with transposable elements and an enzyme, which can randomly insert the transposable elements into the DNA molecules, copying the methylation patterns of the DNA molecules using a DNA methylation-maintenance enzyme, while isothermally amplifying the DNA molecules using a DNA polymerase with strand displacement activity, under conditions that simultaneously promote activity of the DNA methylation-maintenance enzyme and the DNA polymerase; a buffer comprising a divalent ion, deoxynucleotide triphosphates (dNTPs), primers, and S-adenosyl-methionine (SAM); and a composition comprising a DNA methylation-maintenance enzyme, a DNA polymerase with strand displacement activity, and the buffer.
Owner:EUCLID DIAGNOSTICS

Method for treating non-small cell lung cancer

InactiveUS20130310440A1Organic active ingredientsRespiratory disorder5-MethylcytosineBorderline resectable
The present invention provides methods for treating a human patient afflicted with unresectable, advanced or metastatic non-small cell lung cancer comprising periodically administering to the human patient chemotherapy comprising an amount of docetaxel; and 640 mg of an anti-clusterin oligonucleotide having the sequence CAGCAGCAGAGTCTTCATCAT (Seq. ID No.: 1), wherein the anti-clusterin oligonucleotide has a phosphorothioate backbone throughout, has sugar moieties of nucleotides 1-4 and 18-21 bearing 2′-O-methoxyethyl modifications, has nucleotides 5-17 which are 2′deoxynucleotides, and has 5-methylcytosines at nucleotides 1, 4, and 19, thereby treating the human patient afflicted with unresectable, advanced or metastatic non-small cell lung cancer. The present invention also provides compositions and combinations, packages, and uses thereof for treating a human patient afflicted with unresectable, advanced or metastatic non-small cell lung cancer.
Owner:TEVA PHARMA IND LTD

Methods of copying the methylation pattern of DNA during isothermal amplification and microarrays

A method for copying the methylation patterns of molecules of genomic DNA (MGD) during isothermal amplification of the MGD comprising obtaining MGD, copying the methylation patterns of the MGD using a DNA methylation-maintenance enzyme, while isothermally amplifying the MGD using a DNA polymerase with strand displacement activity, under conditions that simultaneously promote activity of the DNA methylation-maintenance enzyme and the DNA polymerase; a method for copying the methylation patterns in double-stranded DNA molecules during isothermal amplification of the DNA molecules comprising obtaining DNA molecules, contacting the DNA molecules with transposable elements and an enzyme, which can randomly insert the transposable elements into the DNA molecules, copying the methylation patterns of the DNA molecules using a DNA methylation-maintenance enzyme, while isothermally amplifying the DNA molecules using a DNA polymerase with strand displacement activity, under conditions that simultaneously promote activity of the DNA methylation-maintenance enzyme and the DNA polymerase; a buffer comprising a divalent ion, deoxynucleotide triphosphates (dNTPs), primers, and S-adenosyl-methionine (SAM); and a composition comprising a DNA methylation-maintenance enzyme, a DNA polymerase with strand displacement activity, and the buffer.
Owner:EUCLID DIAGNOSTICS

β-L-2′-deoxynucleosides for the treatment of resistant HBV strains and combination therapies

ActiveUS7186700B2Preventing and suppressing emergenceBiocidePeptide/protein ingredientsMedicineLamivudine resistance
It has been discovered that β-L-2′-deoxynucleosides are active against drug-resistant hepatitis B virus with mutations. A method for treating lamivudine resistant HBV (M552V) in a host is provided that includes administering a β-L-2′-deoxynucleoside or its pharmaceutically acceptable salt, ester or prodrug. In addition, a method for preventing lamivudine resistant HBV (M552V) mutation from occurring in a naïve host is provided that includes administering a β-L-2′-deoxynucleoside or its pharmaceutically acceptable salt, ester or prodrug. A method for preventing and / or suppressing the emergence of the HBV double mutant (L528M / M552V) in a host is also provided that includes administering a β-L-2′-deoxynucleoside or its pharmaceutically acceptable salt, ester or prodrug.
Owner:NOVARTIS AG

Novel use

The invention relates to the use of specific terminal deoxynucleotidyl transferase (TdT) enzymes in a method of nucleic acid synthesis, to methods of synthesizing nucleic acids, and to the use of kits comprising said enzymes in a method of nucleic acid synthesis. The invention also relates to the use of terminal deoxynucleotidyl transferases and 3′-blocked nucleotide triphosphates in a method of template independent nucleic acid synthesis.
Owner:NUCLERA NUCLEICS LTD

Method for preparing auxin

InactiveCN102145998AReduce manufacturing costEasy to scale production and promotionOrganic fertilisersNucleotideAuxin
The invention discloses a method for preparing auxin, which comprises the following steps of: preparing nucleic acid from byproduct mycelia of a fermentation plant, hydrolyzing with the nucleic acid to prepare a nucleotide salt and a deoxynucleotide salt, and then mixing the nucleotide salt, the deoxynucleotide salt and an auxiliary agent uniformly. The raw materials are extensive, and the method is simple and convenient.
Owner:高旌

Chromophore-modified deoxynucleoside phosphoramidite monomer compound, preparation method therefor and application thereof

The invention discloses a chromophore-modified deoxynucleoside phosphoramidite monomer compound, a preparation method therefor and an application thereof. The preparation method comprises the steps of: connecting chromophores such as pyrene, perylene or naphthalene carboxamide with bis(diisopropylamino) chlorophosphine to obtain a phosphorous intermediate; and reacting the phosphorous intermediate with DMT-protected deoxynucleoside to obtain a chromophore-modified deoxynucleoside phosphoramidite monomer compound. By virtue of solid-phase synthesis of DNA, the compound is inserted into oligonucleotide at a fixed point to obtain a chromophore-modified fluorescent oligonucleotide probe with a stable double-chain structure. The fluorescent oligonucleotide probe is free of fluorescence-emission, and only being combined with a perfectly matching target chain, the fluorescence can be enhanced by 23.5 times, and the response speed is fast. Mismatched bases are obviously identified with nearly no fluorescence-emission, so that single base mismatch can be obviously identified. The compound can be applied to single base mutation analysis of a gene and detection of a PCR reaction process and the like, and is wide in application prospect in aspects of single base polymorphism detection and nucleic acid detection in a biochemical sample and the like.
Owner:PEKING UNIV

Identification of white leghorns red plumage mutagenic mutant genotype and cultivation method for supporting system of red plumage pink shell layer chickens

The present invention discloses a method for breeding the commercial strains of red feather pink-shell laying hens. It provides a primer pair for identifying the red feather causative mutation homozygous genotype of white leghorn chickens, which is composed of the single-stranded DNA molecule shown in Sequence 2 of the Sequence List and the single-stranded DNA molecule shown in Sequence 3 of the list. After the primer was designed according to the upstream and downstream nucleotide sequences of the 18,288,303rd deoxynucleotide in the positive-sense strand of the 11th chromosome as shown in the sequence information of the chicken reference genome Gallus_gallus-4.0 version published in NCBI, the genotype (SNP) at this site is tested through the restriction fragment length polymorphism, the genotype of the site (SNP) was tested through the restriction fragment length polymorphism; the offspring hens obtained by cross breeding the homogenous female parent (the homogenous female parent was obtained through expanded propagation of the white leghorn chickens with the red feather causative mutation homozygous genotype) and the Rhode Island Red rooster as a male parent are all of red feather phenotype, meeting the market demands and enjoying a broad prospect for promotion.
Owner:BEIJING HUADU YUKOU POULTRY

Multiple reverse transcription polymerase chain reaction detection method for swine transmissible gastroenteritis

The invention relates to a multiple reverse transcription polymerase chain reaction detection method for swine transmissible gastroenteritis. An antibody is needed to be prepared by an euzymelinked immunosorbent assay, so that the period is longer, and external factors have larger interference on the diagnostic method of the euzymelinked immunosorbent assay. The method comprises the following steps of: designing and synthesizing a transmissible swine gastroenteritis virus gene primer; establishing a multiple reverse transcription polymerase chain reaction diagnostic method of the transmissible swine gastroenteritis viruses and porcine epidemic diarrhea viruses; optimizing concentration of the primer of a bigeminy reverse transcription polymerase chain reaction; optimizing the concentration of magnesium oxide of the bigeminy reverse transcription polymerase chain reaction; optimizing the concentration of triphosphoric acid base deoxynucleotide of the bigeminy reverse transcription polymerase chain reaction; determining the optimal annealing temperature of the bigeminy reverse transcription polymerase chain reaction; testing the sensitivity of the bigeminy reverse transcription polymerase chain reaction; and testing the specificity of the bigeminy reverse transcription polymerase chain reaction. The multiple reverse transcription polymerase chain reaction detection method for swine transmissible gastroenteritis is suitable for detecting swine transmissible gastroenteritis.
Owner:郑世民
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products