Patents
Literature
Hiro is an intelligent assistant for R&D personnel, combined with Patent DNA, to facilitate innovative research.
Hiro

35 results about "Follicle-stimulating hormone receptor" patented technology

The follicle-stimulating hormone receptor or FSH receptor (FSHR) is a transmembrane receptor that interacts with the follicle-stimulating hormone (FSH) and represents a G protein-coupled receptor (GPCR). Its activation is necessary for the hormonal functioning of FSH. FSHRs are found in the ovary, testis, and uterus.

Pyrrolobenzodiazepine pyridine carboxamides and derivatives as follicle-stimulating hormone receptor antagonists

This invention provides pyrrolobenzodiazepine pyridine carboxamides selected from those of Formula (1), which act as follicle stimulating hormone receptor antagonists. The invention also provides pharmaceutical compositions and methods of treatment utilizing the compounds of Formulae (1) and (2).
Owner:DIRECT CURSUS TECH LLC +1

Pyrrolobenzodiazepine arylcarboxamides and derivatives thereof as follicle-stimulating hormone receptor antagonists

This invention provides pyrrolobenzodiazepine arylcarboxamides selected from those of Formula (1), which act as follicle stimulating hormone receptor antagonists, as well as pharmaceutical compositions and methods of treatment
Owner:WYETH

Pyrrolobenzodiazepine arylcarboxamides and derivatives thereof as follicle-stimulating hormone receptor antagonists

This invention provides pyrrolobenzodiazepine arylcarboxamides selected from those of Formula (1), which act as follicle stimulating hormone receptor antagonists, as well as pharmaceutical compositions and methods of treatment utilizing these compounds.
Owner:WYETH LLC

Pyrrolobenzodiazepine pyridine carboxamides and derivatives as follicle-stimulating hormone receptor antagonists

This invention provides pyrrolobenzodiazepine pyridine carboxamides selected from those of Formula (1), which act as follicle stimulating hormone receptor antagonists. The invention also provides pharmaceutical compositions and methods of treatment utilizing the compounds of Formulae (1) and (2).
Owner:WYETH

PET (Positron Emission Tomography) tracer with FSHR (Follicle-stimulating Hormone Receptor) targeting as well as preparation method and application thereof

The invention relates to a PET (Positron Emission Tomography) tracer which is obtained by polypeptide which is marked by positron imaging nuclide and has FSHR (Follicle-stimulating Hormone Receptor) targeting as well as a preparation method of the PET tracer. The invention also discloses application of the PET tracer in the field of tumor living body monitoring. With the adoption of the PET tracer, the blank in the field of FSHR targeting positron tracers and the technical problem of carrying out horizontal living body monitoring on FSHR are solved, and therefore, the PET tracer is particularly suitable for diagnosis and curative effect monitoring on tumors with high expression of the FSHR.
Owner:JIANGSU INST OF NUCLEAR MEDICINE

FSHR (follicle stimulating hormone receptor) gene based molecular marker related to porcine reproduction traits as well as detection method and application of molecular marker

The invention discloses an FSHR (follicle stimulating hormone receptor) gene based molecular marker related to porcine reproduction traits as well as a detection method and an application of the molecular marker. The molecular marker is a porcine FSHR gene segment which contains a polymorphic locus, and the polymorphic locus is at the 1,166th site in a sequence shown in the SEQ ID NO.1 and has C / T base variation. The detection method comprises the following steps: a primer is designed according to the nucleotide sequence of the molecular marker; PCR (polymerase chain reaction) amplification is performed with genomic DNA of a to-be-detected pig as a template; the type of a polymorphic locus in a PCR amplification product is judged. The invention further discloses the application of the molecular marker in selection of the porcine reproduction traits. According to an FSHR gene mutation site, the FSHR gene based molecular marker related to the porcine reproduction traits as well as the detection method and the application of the molecular marker are provided, and foundation is provided for porcine molecular breeding and development of a physiological mechanism for porcine reproduction.
Owner:JIANGSU POLYTECHNIC COLLEGE OF AGRI & FORESTRY

Method for obtaining FSHR full-length coding region sequence with multiple splice forms

The invention provides a method for obtaining an FSHR (follicle-stimulating hormone receptor) full-length coding region sequence with multiple splice forms. The method comprises the steps: extracting total RNA of a sheep granular cell, and reversely transcribing into cDNA; according to initiation codon upstream and termination codon downstream of a cDNA sequence of a sheep FSHR gene, designing two pairs of primers, wherein an upstream primer F1 is CAAAAGGGCTCAGTGTGGAG, an upstream primer F2 is CGTCTGCAGAAGCAGAAGCA, a downstream primer R1 is CTTATGGATGTGCCAGGGAG, and a downstream primer R2 is AGTGCTCTGTCAGCTCTTGC; taking the obtained cDNA as a template, carrying out PCR amplification of the FSHR gene, and extracting the PCR product by a Tiangen gel extraction kit; and adding an A tail into the PCR product, and cloning, sequencing and verifying an T vector. The obtained FSHR full-length coding region sequence with the multiple splice forms is characterized by comprising the oFSHR695, oFSHR694, oFSHR648, oFSHR633 and oFSHR595.
Owner:新疆维吾尔自治区畜牧科学院中国-澳大利亚绵羊育种研究中心

Follicle stimulating hormone receptor(FSHR) specific binding region polypeptide, its expression vector, preparation method and application in drug preparation

The invention discloses the FSH receptor special bonding area polypeptide, expression vector, the preparation method and their pharmaceutical application. Wherein, the polypeptide has amino acid sequence shown as SEQ ID No.2, SEQ ID No.4 or SEQ ID No.6, and can restrain spermatogenesis safely without effect to androgen and as the gene vaccine for male contraceptive.
Owner:NANJING MEDICAL UNIV

Gene detection method for ovarian response related genes

The invention discloses a gene detection method for ovarian response related genes. The method is characterized in that by detecting and analyzing the gene carrying type of FSHR (Follicle Stimulating Hormone Receptor) gene SNPs (single nucleotide polymorph sims) loci of individuals, the detection on ovarian response related genes is provided for detected people so as to screen infertility susceptible individuals in Chinese female populations; therefore, on the basis of giving infertility attack risks of individuals, the chances of early knowing, preventing and treating infertility genetic susceptibility are provided for Chinese females.
Owner:上海中优医药高科技股份有限公司

Pyrazole compounds as modulators of fshr and uses thereof

Disclosed are pyrazole compounds, and pharmaceutically acceptable compositions thereof. The compounds and the compositions can be used for positive allosteric modulators of follicle stimulating hormone receptor (FSHR).
Owner:ARES TRADING SA

Molecular marker method of two mutation sites in chicken FSHR (Follicle-Stimulating Hormone Receptor) gene 5' control region and applications thereof in children breeding

The invention relates to the field of molecular genetics, in particular to a molecular marker method of two mutation sites in a chicken FSHR (Follicle-Stimulating Hormone Receptor) gene 5' control region and the applications thereof in children breeding. The inventor finds that chicken FSHR 5' control region -237 and -868 sites are not related to properties when single site marker is analyzed but finds that the two sites have remarkable difference (P=0.016) by corresponding a TTG+G- type to a small first laying age (123d) and corresponding a TTG+G+ type to a great first laying age (134d) when using the two site haplotypes to construct doubling types for multiple comparison. Accordingly, the invention can detect the two molecular markers related to the egg laying properties, and the method not only is simple, convenient and rapid, but also avoids environmental influence and can realize early seed section.
Owner:SHANDONG AGRICULTURAL UNIVERSITY

Recombinant human FSHR-57 polypeptide protein and preparation method and application thereof

The invention relates to recombinant human FSHR-57 polypeptide protein and a preparation method and application thereof. The polypeptide vaccine selects N-terminal 57-site amino acid of follicle stimulating hormone receptor (FSHR), contains B cell epitopes and effectively avoids crossing reaction with luteinizing hormone receptor (LHR) and thyroid stimulating hormone receptor (TSHR). The high-purity FSHR-57 polypeptide protein is prepared by using methods of prokaryocyte expression, rubber cutting purification and gradient dialysis renaturation. Non-reduced PAGE + Western blot, HPLC and mass spectrometry amino acid sequencing identification verify that the polypeptide protein prepared by the method is accurate and has the purity of higher than 97 percent. The FSHR-57 polypeptide protein has good safety, does not disturb the level of sex hormone such as testosterone, estradiol and the like, has stronger immunogenicity, and can become a candidate of male contraceptive vaccine.
Owner:NANJING MEDICAL UNIV

Pyrazole compounds as modulators of fshr and uses thereof

The present invention relates to pyrazole compounds, and pharmaceutically acceptable compositions thereof, useful as positive allosteric modulators of follicle stimulating hormone receptor (FSHR).
Owner:MERCK PATENT GMBH

Pyrazole compounds as modulators of FSHR and uses thereof

The present invention relates to pyrazole compounds, and pharmaceutically acceptable compositions thereof, useful as positive allosteric modulators of follicle stimulating hormone receptor (FSHR).
Owner:MERCK PATENT GMBH

B cell epitope of follicle-stimulating hormone receptor and antigen peptides containing thereof

The invention discloses a follicle-stimulating hormone recipient B cell epitope and an antigenic peptide containing the epitope; the follicle-stimulating hormone recipient B cell epitope of the invention has amino acid sequences shown in SEQ ID No.1 and has single component and simple structure, and are free of the impact of bad epitopes in natural proteantigens, and immunoreactions initiated by the epitope of the invention has strong pertinence; the antigenic peptide containing the follicle-stimulating hormone recipient B cell epitope, is obtained by connecting a T accessory cell epitope with the follicle-stimulating hormone recipient B cell epitope in series while the T cell epitope has the amino acid sequences shown in SEQ I D No.2; the antigenic peptide can induce that an antibody of the follicle-stimulating hormone recipient B cell epitope is targeted with high titer in a specific manner and a reversible anti-fertility function with high efficiency and safety is produced, therebybeing capable of preparing a male pregnancy vaccine, having significant social and economic benefits and having important value in theory and wide application prospect.
Owner:ARMY MEDICAL UNIV

A tumor imaging and therapy probe targeting follicle-stimulating hormone receptor and its preparation method and application

In order to solve the problem of accurate identification of lesions during surgery, on the basis of the advantages of near-infrared fluorescent dyes for imaging, its specific imaging is increased. The invention provides a tumor imaging and treatment probe targeting follicle stimulating hormone receptor and a preparation method thereof. In the present invention, the follicle stimulating hormone polypeptide (LYTRDLVYKDPARPKIQKTCTF) is coupled with the near-infrared fluorescent dye Rh760 to form the follicle stimulating hormone receptor-targeted tumor imaging and therapy probe FSH-Rh760. The advantage is that the present invention utilizes FSHR to be highly expressed in ovarian cancer , based on the principle of specific binding of FSH polypeptides to FSHR, targeting ovarian cancer cells. Utilizing the advantages of deeper penetration depth and lower background signal of the near-infrared fluorescent dye Rh760, it has a good application prospect in fluorescence imaging and fluorescence-guided surgery. The targeting probe FSH-Rh760 of the present invention can be used for photothermal therapy of ovarian cancer, as a supplement to surgical treatment, to improve the prognosis of ovarian cancer.
Owner:FUDAN UNIV +1

B cell epitope of follicle-stimulating hormone receptor and antigen peptides containing thereof

The invention discloses a follicle-stimulating hormone recipient B cell epitope and an antigenic peptide containing the epitope; the follicle-stimulating hormone recipient B cell epitope of the invention has amino acid sequences shown in SEQ ID No.1 and has single component and simple structure, and are free of the impact of bad epitopes in natural proteantigens, and immunoreactions initiated by the epitope of the invention has strong pertinence; the antigenic peptide containing the follicle-stimulating hormone recipient B cell epitope, is obtained by connecting a T accessory cell epitope with the follicle-stimulating hormone recipient B cell epitope in series while the T cell epitope has the amino acid sequences shown in SEQ I D No.2; the antigenic peptide can induce that an antibody of the follicle-stimulating hormone recipient B cell epitope is targeted with high titer in a specific manner and a reversible anti-fertility function with high efficiency and safety is produced, thereby being capable of preparing a male pregnancy vaccine, having significant social and economic benefits and having important value in theory and wide application prospect.
Owner:ARMY MEDICAL UNIV

Imidazole compounds as modulators of fshr and uses thereof

The present invention relates to imidazole compounds, and pharmaceutically acceptable compositions thereof, useful as positive allosteric modulators of follicle stimulating hormone receptor (FSHR).
Owner:MERCK PATENT GMBH

Preparation and application of anti-FSHR (follicle stimulating hormone receptor) antibody and antibody-drug conjugate thereof

The invention discloses preparation and application of an anti-FSHR (follicle stimulating hormone receptor) antibody and an antibody-drug conjugate thereof. The invention discloses an antibody or an antigen-binding fragment thereof, the antibody or the antigen-binding fragment thereof comprises a variable region which specifically binds to a human follicle stimulating hormone receptor (FSHR) and comprises one, two, three, four, five or six CDRs selected from amino acid sequences shown as SEQ ID NO: 6, 7, 8, 10, 11 and 12, and the antibody or the antigen-binding fragment thereof comprises one, two, three, four, five or six CDRs selected from amino acid sequences shown as SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 11 and SEQ ID NO: 12. The anti-FSHR antibody and the antibody-drug conjugate thereof provided by the invention have wide application prospects in detection, screening, prevention and treatment of cancers.
Owner:CANWELL BIOTECH LTD

Method of improving litter size of animals

The invention discloses a method of improving the litter size of animals. The invention verifies that the litter size of trans-FSHR (Follicle Stimulating Hormone Receptor)-genic mice is higher than that of non-transgenic mice. The method comprises the following steps: inserting the FSHR gene into an animal chromosome; and verifying to obtain the trans-FSHR-genic animals. Compared with the non-transgenic animals, the litter size of the trans-FSHR-genic animals is improved. The FSHR gene can promote improvement of the litter size of the mice.
Owner:INST OF ANIMAL SCI OF CHINESE ACAD OF AGRI SCI

Optimized synthetic consensus immunogenic compositions targeting the follicle stimulating hormone receptor (FSHR)

Provided herein is an immunogenic composition comprising a synthetic consensus antigen to Follicle Stimulating Hormone Receptor (FSHR) protein which is abundant in many ovarian cancer sub-types. Alsodisclosed herein is a method of treating a tumor associated pathology in a subject in need thereof, by administering the immunogenic composition to the subject.
Owner:THE TRUSTEES OF THE UNIV OF PENNSYLVANIA +2
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products