Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Recombinant human FSHR-57 polypeptide protein and preparation method and application thereof

A FSHR-57, -FSHR57 technology, applied in the field of recombinant human FSHR-57 polypeptide protein and its preparation, can solve the problems of complex components, unclear mechanism, prone to allergic reactions to spermicides, etc., and achieve strong immunogenicity, good safety effect

Inactive Publication Date: 2010-10-20
NANJING MEDICAL UNIV
View PDF1 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Various non-hormonal contraceptives also have shortcomings: spermicides are prone to allergic reactions, and the effect is not satisfactory when used alone; Chinese herbal medicines have large toxic and side effects, complex ingredients and unclear mechanisms, and are currently only used in animal experiments
There is also a lack of in-depth and systematic research on the contraceptive mechanism and safety evaluation

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant human FSHR-57 polypeptide protein and preparation method and application thereof
  • Recombinant human FSHR-57 polypeptide protein and preparation method and application thereof
  • Recombinant human FSHR-57 polypeptide protein and preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] 1. Determine the effective epitope of FSHR-57 protein as vaccine antigen

[0038] The epitope of FSHR was predicted by DNAStar Protein software ( figure 1 ); at the same time, the homology comparison between the FSHR-57 polypeptide and the amino-terminal sequences of LHR and TSHR indicates that this region has a low degree of homology with LHR and TSHR, which can avoid cross-reactivity between FSHR, LHR and TSHR; innovative selection The 57 amino acids (1-57aa) at the N-terminal of FSHR were selected as the target fragment, and the nucleotide sequence and corresponding polypeptide sequence are shown below.

[0039] The nucleotide sequence of FSHR-57 protein is as follows:

[0040] TGTCATCATCGGATCTGTCACTGCTCTAACAGGGTTTTTCTCTGCCAAGAGAGCAAGGTGACAGAGATTCCTTCTGACCTCCCGAGGAATGCCATTGAACTGAGGTTTGTCCTCACCAAGCTTCGAGTCATCCAAAAAGGTGCATTTTCAGGATTTGGGGACCTGGAGAAA

[0041] The amino acid sequence of the FSHR-57 protein polypeptide is as follows:

[0042] CHHRIHCSNRVFLCQESKVTEIPSDLP...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to recombinant human FSHR-57 polypeptide protein and a preparation method and application thereof. The polypeptide vaccine selects N-terminal 57-site amino acid of follicle stimulating hormone receptor (FSHR), contains B cell epitopes and effectively avoids crossing reaction with luteinizing hormone receptor (LHR) and thyroid stimulating hormone receptor (TSHR). The high-purity FSHR-57 polypeptide protein is prepared by using methods of prokaryocyte expression, rubber cutting purification and gradient dialysis renaturation. Non-reduced PAGE + Western blot, HPLC and mass spectrometry amino acid sequencing identification verify that the polypeptide protein prepared by the method is accurate and has the purity of higher than 97 percent. The FSHR-57 polypeptide protein has good safety, does not disturb the level of sex hormone such as testosterone, estradiol and the like, has stronger immunogenicity, and can become a candidate of male contraceptive vaccine.

Description

1. Technical field [0001] The invention belongs to the field of bioengineering, and specifically relates to a recombinant human FSHR-57 polypeptide protein for male contraception, its preparation method and pharmaceutical application. 2. Background technology [0002] With the rapid growth of the world population, the task of population control is more difficult, but in the past most of the responsibilities were borne by women, and the development of society requires men to play an active role. [0003] Male contraceptives under development are divided into hormonal contraceptives and non-hormonal contraceptives (external spermicides, Chinese herbal medicines and contraceptive vaccines). However, no matter whether male hormone contraceptives are used alone or in combination, there are still many unsatisfactory aspects to be improved. Various non-hormonal contraceptives also have shortcomings: spermicides are prone to allergic reactions, and the effect is not satisfactory wh...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K14/72C12N15/12C12N15/63A61K39/00A61P15/16
Inventor 王心如顾爱华龙燕李迎春王守林夏彦恺杨骅
Owner NANJING MEDICAL UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products