Recombinant human FSHR-57 polypeptide protein and preparation method and application thereof
A FSHR-57, -FSHR57 technology, applied in the field of recombinant human FSHR-57 polypeptide protein and its preparation, can solve the problems of complex components, unclear mechanism, prone to allergic reactions to spermicides, etc., and achieve strong immunogenicity, good safety effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0037] 1. Determine the effective epitope of FSHR-57 protein as vaccine antigen
[0038] The epitope of FSHR was predicted by DNAStar Protein software ( figure 1 ); at the same time, the homology comparison between the FSHR-57 polypeptide and the amino-terminal sequences of LHR and TSHR indicates that this region has a low degree of homology with LHR and TSHR, which can avoid cross-reactivity between FSHR, LHR and TSHR; innovative selection The 57 amino acids (1-57aa) at the N-terminal of FSHR were selected as the target fragment, and the nucleotide sequence and corresponding polypeptide sequence are shown below.
[0039] The nucleotide sequence of FSHR-57 protein is as follows:
[0040] TGTCATCATCGGATCTGTCACTGCTCTAACAGGGTTTTTCTCTGCCAAGAGAGCAAGGTGACAGAGATTCCTTCTGACCTCCCGAGGAATGCCATTGAACTGAGGTTTGTCCTCACCAAGCTTCGAGTCATCCAAAAAGGTGCATTTTCAGGATTTGGGGACCTGGAGAAA
[0041] The amino acid sequence of the FSHR-57 protein polypeptide is as follows:
[0042] CHHRIHCSNRVFLCQESKVTEIPSDLP...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com