Patents
Literature
Hiro is an intelligent assistant for R&D personnel, combined with Patent DNA, to facilitate innovative research.
Hiro

58 results about "Molecular genetics technique" patented technology

There are three general techniques used for molecular genetics: amplification, separation and detection, and expression. Specifically used for amplification is polymerase chain reaction, which is an “indispensable tool in a great variety of applications”. In the separation and detection technique DNA and mRNA are isolated from their cells.

Application of MDFI in regulation of pig skeletal muscle growth and development

The present invention relates to the technical field of molecular genetics, and specifically discloses an application of the pig MDFI gene in regulation of pig skeletal muscle growth and development. According to the present invention, MDFI is overexpressed and interfered in pig skeletal muscle satellite cells, results of cell count and EdU fluorescence detection show that the MDFI can significantly promote proliferation of the pig skeletal muscle satellite cells, and the results of detection on the expression levels of MyoD, myogenin and MyHC expression show that the MDFI can inhibit differentiation of the pig skeletal muscle satellite cells; and with qRT-PCR and Western Blot methods, the regulation effect on the MRFs and the associated cyclin is detected after MDFI is overexpressed and interfered, and the regulation mechanism of the MDFI on the proliferation and differentiation effect of the pig skeletal muscle satellite cells is primarily explored so as to provide the theoretical basis for further research of the MDFI on the pig skeletal muscle growth and development at the body level and provide the reference for improvement of the pork production breeding work.
Owner:SOUTH CHINA AGRI UNIV

Molecular marker closely linked with cabbage type rape seed coat color and application of molecular marker

The invention belongs to the technical field of plant molecular genetics, and in particular relates to a molecular marker closely linked with a cabbage type rape seed coat color and an application of the molecular marker. The invention aims to provide a new choice for fine positioning and cloning of color main effect QTL in the future. The invention discloses a molecular marker SWUA09-355 closely linked with the cabbage type rape seed coat color, and has nucleotide sequences shown by SEQ ID NO.1 and SEQ ID NO.2. The invention also provides a primer for amplifying the molecular marker and a method for obtaining the molecular marker. The invention localizes an SSR molecular marker SWUA09-355 closely linked with seed coat color properties, and the main effect QTL can explain 41.38-64.17% of phenotypic variations in different environments.
Owner:SOUTHWEST UNIVERSITY

SNP (Single Nucleotide Polymorphism) molecular marker capable of influencing wool shearing amount of alpine merino and application of SNP molecular marker

The invention belongs to the technical field of molecular genetics, and particularly relates to an SNP (Single Nucleotide Polymorphism) molecular marker influencing the wool shearing amount of alpine merino and application. The SNP molecular marker is located at the 20065540th nucleotide site G / A mutation on the fifth chromosome of the international sheep reference genome Oarv4.0 version. The invention further relates to a specific primer pair for detecting the SNP molecular marker by using a PCR technology, a kit containing the primer pair and a nucleotide polymorphism detection method, and compared with a traditional detection method, the technology has the advantages of high accuracy, high detection speed, low cost, easiness in result judgment and the like. SNP locus detection is used for carrying out early selection of the shearing amount of the high-mountain merino sheep, shortening the breeding period and accelerating the breeding process, a high-mountain merino sheep shearing amount early selection technology is established, the breeding time of the excellent character of the shearing amount of the high-mountain merino sheep is shortened, the breeding cost is reduced, and the application value is very high.
Owner:LANZHOU INST OF ANIMAL SCI & VETERINARY PHARMA OF CAAS

SNP (Single Nucleotide Polymorphism) molecular marker for influencing wool length character of alpine merino and application of SNP molecular marker

The invention belongs to the technical field of molecular genetics, and particularly relates to an SNP molecular marker influencing the wool length character of alpine merino and application. The SNP molecular marker is located at the 24178878th nucleotide site T / C mutation on the 22nd chromosome of the international sheep reference genome Oarv4.0 version. The invention further relates to a specific primer pair for detecting the SNP molecular marker by using a PCR technology, a kit containing the primer pair and a nucleotide polymorphism detection method, and compared with a traditional detection method, the technology has the advantages of high accuracy, high detection speed, low cost, easiness in result judgment and the like. SNP locus detection is used for carrying out early selection of the high-mountain merino wool length character, shortening the cultivation period and accelerating the cultivation process, an early selection technology of the high-mountain merino wool length character is established, the breeding time of the high-mountain merino wool length character is shortened, the breeding cost is reduced, and the application value is very high.
Owner:LANZHOU INST OF ANIMAL SCI & VETERINARY PHARMA OF CAAS

Method for constructing plant transcription factor-to-target gene genetic regulation network

The invention relates to a method for constructing a plant transcription factor-to-target gene genetic regulation network, and belongs to the technical field of molecular genetics. The method comprises the following steps: obtaining SNP genotype data of a plant transcription factor to be detected in each individual in a group, expression quantity data of a specific tissue of the plant transcription factor to be detected in each individual in the group, and expression quantity data of a same tissue of a plant candidate target gene to be detected in each individual in the group; determining SNPsignificantly associated with the candidate target gene expression quantity; determining candidate target genes highly related to the expression quantity of the transcription factor to be detected. When the determination conditions are met at the same time, it is indicated that the transcription factor to be detected regulates the expression of the candidate target genes, and a genetic regulationnetwork of the transcription factor to the target gene can be constructed accordingly. According to the method, the regulation relationship between a plant transcription factor and downstream target genes can be accurately identified in a high-throughput manner, and a genetic regulation network of the transcription factor to the target gene is constructed.
Owner:BEIJING FORESTRY UNIVERSITY

Cultivation method and application of bonsai ornamental rice

The invention relates to the technical field of landscape rice breeding and molecular genetics and particularly discloses a cultivation method and an application of bonsai ornamental rice. The cultivation method comprises the steps as follows: a short stalk cluster mutant and a receptor parent are hybridized to obtain F1; the F1 generation is continuously backcrossed with the receptor parent to obtain a BC1F1 generation, and single plant DNA is extracted at the seedling stage of the BC1F1 generation for molecular mark detection; the BC1F1 generation is continuously backcrossed with the receptor parent to obtain a BC2F1 generation, and single plant DNA is extracted at the seedling stage of the BC2F1 generation for molecular mark detection; the BC2F1 generation and the receptor parent are subjected to advanced backcross to obtain a BCnF1 generation, and single plant DNA is extracted at the seedling stage of the BCnF1 generation for molecular mark detection; a bonsai ornamental rice variety is bred from descendant strains of the BCnF1 after advanced backcross. As detection auxiliary selection is performed by mutant gene molecular markers at the seedling stage of lower generations, thebreeding process is accelerated, and the breeding efficiency is improved; the cultivated short stalk cluster bonsai ornamental rice variety can enrich bonsai types, popularize rice knowledge and deepen understanding of Chinese farming culture.
Owner:江西省农业科学院水稻研究所

Functional molecular marker of rice nilaparvata lugens resistance gene Bph9, identification method and application

ActiveCN109762929ADefects such as limited applicationInsufficient restrictionsMicrobiological testing/measurementPlant genotype modificationForward primerAgricultural science
The invention relates to the technical field of rice resistance breeding and molecular genetics, and particularly discloses a functional molecular marker of a rice nilaparvata lugens resistance gene Bph9, an identification method and application. The molecular marker is Bph9-M, and the nucleotide sequence thereof is shown in a sequence table SIPOSequenceListing 1.0; a Bph9-M primer is a forward primer TCATTAGGAACAGGCTATGCA and a reverse primer TTCTTGTTGACACCGCTCAC. The application of the molecular marker Bph9-M in the breeding of rice nilaparvata lugens resistance includes the following stepsof extracting rice genomic DNA, conducting PCR amplification detection for genotype identification and conducting rice nilaparvata lugens resistance phenotype identification. The molecular marker caneffectively distinguish the Bph9 from other alleles of Bph1, Bph2, Bph7, Bph10, Bph18, Bph21 and the like, be a PCR type intronic functional molecular marker designed for the Bph9 gene, and can carryout rice breeding practice in a simple, rapid and high-throughput manner.
Owner:江西省农业科学院水稻研究所

Rice Magnaporthe grisea DNA fingerprint belt-type encoding system classifying and analyzing method

The invention relates to a rice Magnaporthe grisea DNA fingerprint belt-type encoding system classifying and analyzing method, which comprises ill strain acquisition, separating single-spore bacterial strain, extracting genome DNA, expanding rep-PCR, forming fingerprint pattern through electrophoresis, and obtaining encoding pattern based on the fingerprint pattern. The invention realizes fast monitoring for rice bacterium variation by means of molecular genetics, and provides feasible encoding formula for easy reading and comparison of research result at different places.
Owner:JIANGSU ACADEMY OF AGRICULTURAL SCIENCES

SNP molecular marker influencing weaning weight character of merino and application of SNP molecular marker

The invention belongs to the technical field of molecular genetics, and particularly relates to an SNP molecular marker influencing weaning weight character of merinos and application. The SNP molecular marker is located at the 3566348 nucleotide site T / C mutation on the 23<rd> chromosome of the international sheep reference genome Oar_v4.0 version. The invention further relates to a specific primer pair for detecting the SNP molecular marker by using a PCR technology, a kit containing the primer pair, and a nucleotide polymorphism detection method. Compared with a traditional detection method, the technology has the advantages of high accuracy, high detection speed, low cost, easiness in result judgment and the like. SNP locus detection is used for carrying out early selection of the weaning weight characters of high-mountain merinos, shortening the breeding period and accelerating the breeding process, an early selection technology of the weaning weight characters of the high-mountain merinos is established, the breeding time of the excellent weaning weight characters of the high-mountain merinos is shortened, the breeding cost is reduced, and the application value is very high.
Owner:LANZHOU INST OF ANIMAL SCI & VETERINARY PHARMA OF CAAS

Specific amplification primer group for simultaneously amplifying 25 human STR (short tandem repeat) gene loci, fluorescence labeling amplification kit, application and method

The invention relates to a specific amplification primer group for simultaneously amplifying 25 human STR (short tandem repeat) gene loci, a fluorescence labeling amplification kit, application and a method, and belongs to the technical field of molecular genetics. The specific amplification primer group disclosed by the invention comprises primers with nucleotide sequences as shown in SEQ ID NO: 1-50, and 25 corresponding human STR gene loci comprise 23 autosomal STR gene loci and 2 sex identification STR gene loci. The loci corresponding to the specific amplification primer group comprise all loci required by mainstream cases in the market at present, and also comprise two gender identification loci, so that the risk of gender identification errors caused by Y chromosome deletion can be effectively prevented. and the 25 gene loci are combined, so that the method has the characteristics of high individual recognition capability and high non-father exclusion rate.
Owner:百特元生物科技(北京)有限公司

Primer group and kit for simultaneously amplifying 44 Y-STR gene loci of human and application thereof

The invention provides a primer group and a kit for simultaneously amplifying 44 Y-STR gene loci of human and application thereof, and belongs to the technical field of molecular genetics. According to the present invention, the 44 Y-STR gene loci comprise 41 Y chromosome STR gene loci and 3 Y-indel gene loci, including all the gene loci of the mainstream kit in the market; according to the invention, 44 gene loci can be simultaneously amplified in one reaction, the amplification time can be shortened, and the identification efficiency and the detection material adaptability of the kit are improved.
Owner:百特元生物科技(北京)有限公司

lncRNA marker related to porcine skeletal muscle satellite cell proliferation and application of lncRNA marker

The invention belongs to the technical field of molecular genetics, and particularly relates to an lncRNA marker related to porcine skeletal muscle satellite cell proliferation and application of the lncRNA marker. The lncRNA marker is lnc-88672, and a nucleotide sequence of the lncRNA marker is SEQ ID NO.1. It is found for the first time that the expression of the lnc-88672 is related to the porcine skeletal muscle satellite cell proliferation and is continuously reduced along with the continuous increase of the day age of a pig, so that the lncRNA marker related to the porcine skeletal muscle satellite cell proliferation is provided; the porcine skeletal muscle satellite cell proliferation condition can be identified by detecting the expression of the lnc-88672; the inhibition of the expression of the lnc-88672 can promote the porcine skeletal muscle satellite cell proliferation; and a new idea and method are provided for clinical research of porcine skeletal muscle growth and development.
Owner:SHANXI AGRI UNIV

Primer group and kit for simultaneously amplifying 13 human STR gene loci and application of primer group and kit

The invention provides a primer group and a kit for simultaneously amplifying 13 human STR gene loci and application of the primer group and the kit, and belongs to the technical field of molecular genetics. In the invention, the 13 STR gene loci comprise 12 autosomal STR gene loci and one sex identification STR gene locus. According to the method, 13 STR gene loci with fragments smaller than 320 bp can be amplified in one reaction at the same time, 8 core gene loci and 5 preferable gene loci specified by the Ministry of Public Security are included, meanwhile, a sex identification gene locus is further included, and the problem that detection of trace and degraded large-fragment gene loci of a detected material is lost can be effectively prevented. The 13 STR gene loci are combined with mainstream kits in the market, and more gene locus information can be obtained for trace and degraded DNA, so that the individual recognition capability is effectively improved.
Owner:百特元生物科技(北京)有限公司

Method for identifying shellfish germplasm through combination of morphology with molecular biology

The invention relates to the technical field of identification of species of mariculture shellfish, in particular to a method for identifying species of shellfish samples by using morphology and molecular biology technologies. According to the method, shellfish are identified with a method combining a morphology method with a molecular biology method, the shellfish samples having certain morphological characteristics are accurately identified with the molecular biology method, morphological characteristics applicable to species identification are summarized, a morphological characteristic retrieve table is established, then species of other samples are identified by the aid of the morphological characteristic retrieve table, and verification is performed with the molecular biology method, so that the identification accuracy of shellfish germplasm resources can be significantly improved, and multiple difficulties in previous species identification are eliminated.
Owner:ZHEJIANG MARICULTURE RES INST

Gentamycin JI-20B gene engineering bacterium, and construction and application thereof

InactiveCN103740627ABiosynthesis precisely blockedBiosynthesis blockBacteriaMicroorganism based processesBiotechnologyShuttle vector
The invention discloses gentamycin JI-20B gene engineering bacterium, and construction and application thereof, and belongs to the technical field of biological medicine. Gentamycin JI-20B is directionally synthesized by constructing specific shuttle vector pFD605, utilizing molecular genetics technology to introduce micromonospora, accurately knocking out genB3 gene and genP gene in Micromonospora purpurea by means of frame deletion principle, and permanently inactivating the biological catalysis function of Micromonospora purpurea, utilizing a resistance marker to screen double-crossover mutant strain MicromonosporapurpureaB3P1220 (delta genB3P(gntJI)), performing fermentation on the mutant strain, extracting metabolite, performing structure analysis, and determining that the structure is anastomotic with that of prediction. The constructed engineering bacterium B3P1200 contains no any resistankt markers and the output of gentamycin JI-20B is stable.
Owner:福州市鼓楼区荣德生物科技有限公司

Primer group and kit for simultaneously amplifying 34 human STR gene loci and application of primer group and kit

PendingCN112852972AImprove individual recognitionHigh sensitivityMicrobiological testing/measurementDNA/RNA fragmentationCore geneY chromosome deletions
The invention provides a primer group and a kit for simultaneously amplifying 34 human STR gene loci and application of the primer group and the kit, and belongs to the technical field of molecular genetics. In the invention, the 34 STR gene loci comprise 29 autosomal STR gene loci, one Y chromosome STR gene locus and 4 sex identification STR gene loci. According to the invention, 34 STR gene loci can be simultaneously amplified in one reaction, 20 core gene loci and 10 preferable gene loci specified by Ministry of Public Security are included, all loci of mainstream kits in the current market are included, and meanwhile, 5 gender identification gene loci are also included; and the risk of gender identification errors caused by Y chromosome deletion can be effectively prevented. 34 STR gene loci are combined, so that the method has the characteristics of high individual recognition capability and high non-father exclusion rate.
Owner:百特元生物科技(北京)有限公司

Detection kit and detection method for chicken miRNA-1606 gene polymorphism

The invention discloses a detection kit and a detection method for chicken miRNA-1606 gene polymorphism, and belongs to the technical field of molecular genetics. The detection method comprises the steps of by using chicken whole genome DNA as a template, designing a primer to amplify a target fragment including a miRNA-1606 precursor, purifying and sequencing to know that the 35th site of the chicken miRNA-1606 gene has C or A nucleotide polymorphism; then designing a primer to amplify gene segments containing polymorphism sites and extending reactions by adopting matrix assistant laser desorption ionization-time of flight mass spectrometry in combination with a single primer, and carrying out single SNP site detection on a lot of samples. The detection method has the advantages of high accuracy, sensitive throughput, short detection time and high ratio of performance to cost, can be used for assistant selection and molecular breeding of the chicken, and has important effects for increasing growth traits of the chicken.
Owner:HENAN AGRICULTURAL UNIVERSITY

SNP (Single Nucleotide Polymorphism) marker for influencing wool length of alpine merino sheep and application of SNP marker

The invention belongs to the technical field of molecular genetics, and particularly relates to an SNP (Single Nucleotide Polymorphism) marker related to influence on the wool length of alpine merino and application of the SNP marker, and the SNP molecular marker is located at the 6296384 nucleotide site T / C mutation on the No.3 chromosome of the international sheep reference genome Oarv4.0 version. The invention further relates to a specific primer pair for detecting the SNP molecular marker by using a PCR technology, a kit containing the primer pair and a nucleotide polymorphism detection method, and compared with a traditional detection method, the technology has the advantages of high accuracy, high detection speed, low cost, easiness in result judgment and the like. SNP locus detection is used for carrying out early selection of the wool length of the high-mountain merino sheep, shortening the breeding period and accelerating the breeding process, a technology for selecting the wool length of the high-mountain merino sheep in the early stage is established, the breeding time of excellent characters of the wool length of the high-mountain merino sheep is shortened, the breeding cost is reduced, and the application value is very high.
Owner:LANZHOU INST OF ANIMAL SCI & VETERINARY PHARMA OF CAAS

Primer group and kit for simultaneously amplifying 37 Y-STR gene loci of human and application thereof

The invention provides a primer group and a kit for simultaneously amplifying 37 Y-STR gene loci of human and application thereof, and belongs to the technical field of molecular genetics. In the invention, the 37 Y-STR gene loci comprise 36 Y chromosome STR gene loci and 1 Y-indel gene locus; 37 gene loci can be amplified in one reaction at the same time, the compatibility of current public security DNA database comparison is fully met, the amplification time is shortened, the identification efficiency and the detection material adaptability of the kit are improved, and the multifunctional STR identity identification requirements of current forensic identity identification, forensic DNA database construction and judicial genetic relationship identification can be met.
Owner:百特元生物科技(北京)有限公司

Method for identifying chicken abdominal fat mass by using chicken CEBP zeta gene and application of method

The invention discloses a method for identifying chicken abdominal fat mass by using a chicken CEBP zeta gene and application of the method, belongs to the technical field of animal molecular genetics, and aims to more accurately and conveniently identify low-fat broiler chickens and accelerate the breeding process of the broiler chickens. Primers are designed according to upstream 123bp and downstream 302bp sequences of the chicken CEBP zeta gene SNP (single nucleotide polymorphism) locus g.764T>G, the obtained primers are used for performing PCR (polymerase chain reaction) amplification on chicken genome DNA, an amplification product is subjected to enzyme digestion by restriction endonuclease, an enzyme digestion product is subjected to agarose gel electrophoresis separation, and a marker genotype of chicken abdominal fat content is obtained. The method is simple to operate, low in cost and high in accuracy, can be used for automatic detection, is an effective molecular marker breeding means, and provides a scientific basis for marker-assisted selection of chickens, and with adoption of the method, acceleration of the broiler chicken breeding process and cultivation of low-fat broiler chickens meeting market requirements are facilitated, so that relatively good economic benefits are obtained.
Owner:NORTHEAST AGRICULTURAL UNIVERSITY

Haplotype molecular markers related to high fecundity of sheep, screening method and application

The invention discloses a haplotype molecular markers related to high fecundity of sheep, a screening method and application, and belongs to the technical field of molecular genetics. The haplotype molecular markers are composed of an SNP1, an SNP2 and an SNP3; the SNP1 is located at the 735bp position of the MTNR1A gene, and the basic group at the position is G or A; the SNP2 is located at the 753bp position of the MTNR1A gene, and the basic group at the position is G or A; and the SNP3 is located at the 845bp position of the MTNR1A gene, and the basic group at the position is C or A. When the tested sheep SNP1 base is G, SNP2 base is G, SNP3 base is C, and they are all homozygous, or when a haplotype is GGC, the sheep to be detected is a high-fecundity individual. The invention provides an effective and accurate molecular breeding marking method for sheep breeding, which can improve the accuracy and breeding process of group selection, and can play a role in molecular breeding of multifetal mutton sheep and multifetal fine-wool sheep.
Owner:XINJIANG ACADEMY OF AGRI & RECLAMATION SCI

Myristoylated polypeptide for coding mitochondrial localization as well as preparation method and application of myristoylated polypeptide

The invention provides a myristoylated polypeptide for coding mitochondrial localization as well as a preparation method and application thereof, and belongs to the technical field of molecular genetics. The polypeptide sequence has an amino acid sequence represented by an M-N formula, M is an amino acid sequence represented by SEQ ID No. 1, and N is an amino acid sequence represented by SEQ ID No. 2. The invention also discloses application of the polypeptide, a polypeptide composition, a nucleic acid and a polypeptide conjugate in expression of the myristoylated mitochondrial localization protein. The amino terminal of the sequence provided by the invention has a myristoylated conserved sequence which can be myristoylated and then inserted into a mitochondrial cell membrane.
Owner:SUZHOU UNIV

Method for identifying transcription regulation relationship of plant endogenous siRNA

The invention provides a method for identifying the transcription regulation relationship of plant endogenous siRNA, and relates to the technical field of molecular genetics. According to the identification method disclosed by the invention, target genes of plant endogenous siRNA are mined in batches by utilizing a miRNA sequencing and degradation group sequencing data system, so that important information is provided for functional research of the small interfering RNA. According to the identification method disclosed by the invention, a second-generation high-throughput sequencing technologyis fully utilized, high-throughput screening can be carried out on the siRNA and the target genes thereof, and the complexity of a genetic transformation means is overcome; and the method can identify the target genes for siRNA transcriptional regulation more accurately, and has important theoretical significance and practical value for functional research of the siRNA.
Owner:BEIJING FORESTRY UNIVERSITY

Application of integrated high-frequency gene loci of high and medium risk type HPV related to cervical cancer generation

The invention discloses application of integrated high-frequency gene loci of high-and-medium-risk HPV related to cervical cancer occurrence, and belongs to the technical field of molecular genetics. Corresponding PCR amplification upstream and downstream primers are designed aiming at integration sites CCAT1, CSMD3, PABPC1P2, RAD51B, TENM2, CSMD1, GRIA3, DPP10, SLC25A51P1, CDH6 and CTNND2 of high and medium risk HPV, and are assembled to obtain the corresponding kit for detecting cervical cancer high risk groups, and the kit has the advantages of rapidness, convenience, accuracy, low false positive rate and the like, is good in innovation and is helpful for clinical diagnosis.
Owner:WUHAN KDWS BIOLOGICAL TECH CO LTD

Method for amplifying rice aroma gene Badh2 sequence

The invention belongs to the technical field of molecular genetics, and particularly relates to a method for amplifying a rice aroma gene Badh2 sequence. The method for amplifying the rice aroma gene Badh2 sequence comprises the steps that 1, a specific primer set with the sequence shown in the SEQ ID No.1-26 is included; 2, basic group substitution or deficiency or addition is performed; 3, a polymerase chain reaction is performed in a PCR amplification system to obtain the rice aroma gene Badh2 sequence. The method has the advantages of being simple, rapid, low in technical requirement and accurate in result identification, can be used for identifying rice aromatic varieties and rice non-aromatic varieties, can also be used for identifying directive breeding rice aromatic varieties, can be used for genetic identification of conventional rice and bridge materials and plays an important role in various processes of molecular marker directive breeding rice varieties.
Owner:GUANGXI ZHUANG AUTONOMOUS REGION ACAD OF AGRI SCI

A molecular marker method for predicting and identifying chicken belly fat mass and its application

The invention discloses a molecular marker method and application for predicting and identifying chicken abdominal fat mass, belonging to the technical field of animal molecular genetics. The method provided by the present invention is to design primers according to the SNP site c.1880C>T upstream and downstream 190bp sequence of the egg white precursor processing enzyme 1 gene, and then carry out PCR amplification of chicken genomic DNA according to the obtained primers, and then use restriction endonuclease Enzyme digests the amplified product, then electrophoresis separates the digested product, and finally uses PCR‑RFLP technology to analyze gene polymorphisms to obtain chicken abdominal fat marker genotypes. The method provided by the invention has the characteristics of simple operation, low cost and high precision, can carry out automatic detection, is an effective molecular marker breeding method, and can greatly speed up the breeding process of chickens.
Owner:NORTHEAST AGRICULTURAL UNIVERSITY

Mutant DNA polymerases and their genes

The present invention relates to mutant DNA polymerases, their genes and their uses. More specifically, the present invention relates to mutant DNA polymerases which are originally isolated from Thermococcus sp NA1. strain and produced by site-specific mutagenesis, their amino acid sequences, genes encoding said mutant DNA polymerases, their nucleic acids and PCR methods by using thereof. As mutant DNA polymerases according to the present invention have decreased proofreading activity and changed function of inosine sensing effectively compared to wild type DNA polymerase, PCR using primers with specific nucleic acids has made rapid progress. Therefore, the present invention is broadly applicable for PCR in various molecular genetic technologies.
Owner:KOREA OCEAN RES & DEV INST

SNP (Single Nucleotide Polymorphism) molecular marker for identifying age-round shearing amount of alpine merino and application of SNP molecular marker

The invention belongs to the technical field of molecular genetics, and particularly relates to an SNP (Single Nucleotide Polymorphism) molecular marker for identifying the age-round shearing amount of alpine merino and application of the SNP molecular marker. The SNP molecular marker is located at the 20077683th nucleotide site G / C mutation on the fifth chromosome of the international sheep reference genome Oarv4.0 version. The invention further relates to a specific primer pair for detecting the SNP molecular marker by using a PCR technology, a kit containing the primer pair and a nucleotide polymorphism detection method, and compared with a traditional detection method, the technology has the advantages of high accuracy, high detection speed, low cost, easiness in result judgment and the like. SNP locus detection is used for carrying out early selection of the annual shearing amount of the alpine merino sheep, shortening the breeding period and accelerating the breeding process, an early selection technology of the annual shearing amount of the alpine merino sheep is established, the breeding time of the excellent character of the annual shearing amount of the alpine merino sheep is shortened, the breeding cost is reduced, and the application value is very high.
Owner:LANZHOU INST OF ANIMAL SCI & VETERINARY PHARMA OF CAAS

A molecular marker method and application for simultaneously predicting abdominal fat traits, leg bone traits and reproductive performance of broilers

The invention discloses a molecular marking method for simultaneously predicting abdominal fat characters, leg skeleton characters and reproductive performance of broilers and an application, and belongs to the technical field of animal molecular genetics. The invention discloses a method for identifying low-fat broilers more accurately and conveniently and accelerating broiler breeding process. According to the invention, primers are designed according to the sequences from the 208 bp at the upstream to the 72 bp at the downstream of the SNP locus g.3656C > T of the chicken SREBP1 gene exon 3to obtain an amplification primer, then carrying out PCR amplification on the chicken genomic DNA according to the obtained primer, and carrying out enzyme digestion on the amplification product by using restriction endonuclease to obtain the chicken marker genotype. The method is simple to operate, low in cost and high in accuracy, can be used for automatic detection, is an effective molecular marker breeding means, and can be used for accelerating the breeding process of chickens and cultivating low-fat broilers with healthy leg bones and good reproductive performance, which meet market requirements, so that good economic benefits are obtained.
Owner:NORTHEAST AGRICULTURAL UNIVERSITY

A SNP molecular marker affecting weaning weight traits of Alpine Merino sheep and its application

The invention belongs to the technical field of molecular genetics, and in particular relates to a SNP molecular marker affecting the weaning weight traits of Alpine Merino sheep and its application. The SNP molecular marker is located at the T / C mutation at the 3566348th nucleotide site on chromosome 23 of the International Sheep Reference Genome Oar_v4.0 version. The present invention also relates to a specific primer pair for detecting the above-mentioned SNP molecular marker using PCR technology, a kit containing the primer pair and a detection method for nucleotide polymorphism. Compared with the traditional detection method, the technology has high accuracy and is It has the advantages of fast speed, low cost, and easy judgment of results. Using SNP locus detection for early selection of weaning heavy traits in alpine Merino sheep, shortening the breeding cycle and speeding up the breeding process, establishing an early selection technology for weaning heavy traits in alpine Merino sheep, reducing the weaning weight of alpine Merino sheep The breeding time of excellent traits reduces the breeding cost and has high application value.
Owner:LANZHOU INST OF ANIMAL SCI & VETERINARY PHARMA OF CAAS
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More