152 results about "Acute cerebral infarction" patented technology

The present invention relates to an isoquinoline compound represented by the following formula (I) or (II), an optically active form thereof, a pharmaceutically acceptable salt thereof, a water adduct thereof, a hydrate thereof and a solvate thereof, as well as an agent for the prophylaxis and / or treatment of a disease caused by hyperreactivity of poly(ADP-ribose)polymerase, containing the compound, and a poly(ADP-ribose)polymerase inhibitor containing the compound. In addition, this compound is useful as an agent for the prophylaxis and / or treatment of cerebral infarction, particularly as an agent for the prophylaxis and / or treatment of acute cerebral infarction.

The invention relates to a medicament for treating cerebral infarction. A preparation method comprises the following steps: using gingko leaves, hawthorn leaves, angelica, rhizoma gastrodiae, caulis milletiae, sweetgum fruit, earthworm, uncaria, clematis root, dried orange peel and licorice as raw material drugs, adding water into the raw material drugs and decocting the mixture, condensing the decoction to be thick paste, drying and crushing the thick paste into medicinal powder, filling the medicinal powder into capsules, sterilizing and disinfecting the capsules to obtain the capsule preparation. The medicament treats both symptoms and root causes during cerebral infarction treatment, has the characteristics of definite effect and quick healing, has no toxic and side effect or allergic reaction, uses little amount of medicament, has low cost, has obvious effect on acute cerebral infarction, can also control disease development of chronic cerebral infarction, and is easy to be accepted by patients. The cure rate for treating the acute cerebral infarction is 96 percent, and the cure rate for treating the chronic cerebral infarction is 93 percent.

The invention discloses an application of serum exosomes miR-9-3p and miR-124-3p as diagnosis markers of acute cerebral infarction, wherein sequences of the miR-9-3p and miR-124-3p are shown as AUAAAGCUAGAUAACCGAAAGU and UAAGGCACGCGGUGAAUGCC. The exosomes in serum are precipitated by virtue of a high-molecular polyme, and the expression and differences of the brain tissue specific miR-9-3p and miR-124-3p in serum exosomes of a patient with stroke and a healthy person are analyzed by virtue of a real-time fluorescent quantitative polymerase chain reaction (PCR) technology. In the case of acute stroke, the brain tissue specific miR-9-3p and miR-124-3p enter peripheral blood in the form of the exosomes, with a level obviously increased in comparison with a control group, and expression quantities are positively correlated to a degree of brain injury; therefore, the miR-9-3p and miR-124-3p can be used as the markers for judging cerebral ischemic injury and degree.

A new active oxygen scavenger which comprises as an active ingredient a tetrazolylalkoxy-dihydrocarbostyril compound of the formula (I): wherein R is cycloalkyl group, A is lower alkylene group, and the bond between 3- and 4-positions of the carbostyril nucleus is single bond or double bond, or a salt thereof, and an agent for the prevention or treatment of an acute cerebral infarction comprising the same active ingredient.

The invention relates to a marker for early diagnosis of cerebral infarction and application thereof. The marker is composed of multiple nucleic acid molecules, and each nucleic acid molecule encodes at least one microRNA (ribonucleic acid) sequence; and the multiple nucleic acid molecules at least contain a nucleic acid molecule for encoding any one of hsa-miR-106B-5P, hsa-miR-4306, hsa-miR-320e and hsa-miR-320d. The invention also provides a kit for distinguishing at least one plasma of a patient with cerebral infarction and at least one plasma of a healthy individual, which contains the marker for early diagnosis of cerebral infarction, wherein the at least one control plasma is from the healthy individual. The invention has the advantages of being effectively used for observing early occurrence and development of cerebral infarction and providing the marker for early diagnosis of cerebral infarction.

An objective of the present invention is to provide a suppressant for cerebral infarction occurred after long-term ischemia associated with actual cerebral infarction, and has fewer side effects. The cerebral infarction suppressant of the present invention is characterized in comprising an anti-HMGB1 monoclonal antibody as an active ingredient.

The invention belongs to a medicine technology field, relates to a new scutellarin compound and the application of the new scutellarin. The invention precisely relates to the new scutellarin compound for treating cardiocerebral vascular diseases. The general formula of the hydroxyethyl (hydroxypropyl or hydroxybutyl) scutellarin compound in the invention is (I), in which R4 is H or Alkyl; R1, R2 and R3 are hydroxyethyl (hydroxypropyl or hydroxybutyl) or H, among which at least one of R1, R2 and R3 is the hydroxyethyl (hydroxypropyl or hydroxybutyl). The new scutellarin compound is substantially used in the prevention and treatment of cardiocerebral vascular diseases, Alzheimer diseases, cerebral infarction, cerebral ischemia and other varied diseases caused by the cerebral ischemi, etc.

The invention discloses a medicament for treating cerebral infarction, which is prepared from the following raw material medicaments in part by weight: 100 to 500 parts of root of red rooted salvia, 200 to 600 parts of astragalus, 1 to 300 parts of leech, 20 to 400 parts of earthworm, 20 to 400 parts of Chinese angelica, 1 to 260 parts of root of pseudo-ginseng, 20 to 400 parts of drynaria rhizome, 1 to 320 parts of coptis root and 20 to 400 parts of Szechuan lovage rhizome. The Chinese medicinal preparation has main functions of promoting blood circulation and tonifying qi, dissolving stasis and dredging channels, and is used for qi deficiency and blood stasis symptoms of cerebral infarction such as hemiplegia, skew mouth and tongue, obscure words, hemiparesthesia, hard breathing, lacking in strength and the like.

The present invention relates to the use of recombinant human kallidinogenase composition in preparing medicine for preventing and treating cerebral infarction. The recombinant human kallidinogenase composition is prepared with recombinant human kallidinogenase through combination with the host cell expressing the recombinant protein by means of molecular biology technology. It has obvious effect of preventing and treating cerebral infarction. The recombinant human kallidinogenase composition of the present invention is normally in the form of medicine composition, such as freeze dried powder for injection or liquid injection.

Methods and pharmaceutical compositions for treating severe ischemic events including cerebral infarction, cardiac infarction, or pulmonary embolism, comprising a thrombolytic intervention including thrombolytic agents and an inhibitor of vascular endothelial growth factor (VEGF) receptor-mediated signal transduction are disclosed.

The present invention relates to medicine, and is especially one kind of breviscapine-nanometer polymer preparation and its preparation process. The breviscapine-nanometer polymer preparation is prepared with breviscapine and nanometer polymer as carrier material in the weight ratio of 1 to 5-20. The breviscapine-nanometer polymer preparation has simple preparation process, and is applied clinically in treating cardiac and cerebral vascular diseases, such as cerebral thrombosis, cerebral infarction, coronary heart disease, etc.

The invention provides application of a serum exosome miR-410-3p serving as an acute cerebral infarction diagnosis marker and a detection method thereof. The sequence of the serum exosome miR-410-3p is AATATAACACAGATGGCCTGT, and the serum exosome miR-410-3p is a biomarker for acute cerebral infarction diagnosis and treatment. The detection method of the serum exosome miR-410-3p comprises the following steps of collecting serum; separating exosomes in the serum, carrying out small RNA sequencing on the exosomes in the serum through Illumina to obtain a miRNAs expression profile, and carrying out bioinformatics analysis to screen differential expression miRNAs among samples; and analyzing the expression of the brain tissue specific miR-410-3p in serum exosomes of stroke patients and healthypeople by using a real-time fluorescent quantitative polymerase chain reaction technology. According to the research, the level of miR-410-3p in serum exosomes of stroke patients is remarkably increased (P is smaller than 0.001) compared with that of a control group, so that after acute cerebral infarction, brain tissue specificity miR-410-3p enters peripheral blood in an exosome form, and the level is remarkably increased compared with that of the control group; and therefore, the serum exosome can be used as acute cerebral ischemic injury diagnosis markers.

The invention provides a novel plasma filter device for treatment of acute cerebral infarction and filter method of the novel plasma filter device. The device comprises a shell and a filter element. The shell comprises an upper shell body and a lower shell body connected with the upper shell body. The upper shell body and the lower shell body form an accommodating space. The filter element is arranged in the accommodating space and comprises first filter films, a second filter film and a third filter film. The filter element is formed in the mode that the first filter film, the second filter film, the first filter film, the first filter film and the third filter film are arranged sequentially in the plasma flowing direction, wherein the first filter films are DELP films with a lipidosome and fibrinogen affinity adsorption function, the second filter film is an EKSP depth filtering film capable of adsorbing inflammatory factors and free radicals, and the third filter film is a 0.2 micrometer-thick film used for filtering out various granular substances with the hole diameter being greater than 0.2 micrometer. The novel plasma filter device for treatment of acute cerebral infarction and the filter method of the novel plasma filter device have the advantages that the plasma filter device can be used for filtering the plasma of an acute cerebral infarction patient.

The present invention is one kind of red peony injection prepared with red peony root as material and through alcohol extraction, n-butanol extraction or macroporous resin purification, and adding proper amount of medicinal supplementary material and injection water. It is stable and may be used in intramuscular injection, intravenous injection and intravenous instillation. Pharmacodynamic experiment shows that the medicine of the present invention can improve the behavior disorder of rat with cerebral infarction obviously, reduce the area of cerebral infarction, decrease water content in infracted brain tissue, reduce the peroxidation damage of lipoid in brain tissue and raise the acute oxygen lack tolerance of mouse and thus has excellent treat effect on cerebral infarction.

The invention belongs to the field of biological detection, and relates to a reagent for predicting micro-bleeding of an acute cerebral infarction patient. The reagent consists of reagents for detecting any one or more of adiponectin, E-selectin, S100B proteins and soluble advanced glycation end product receptors sRAGE. The content of the adiponectin, the E-selectin, the S100B proteins and the soluble advanced glycation end product receptors in the venous blood of the acute cerebral infarction patient is detected, so that the occurrence possibility of micro-bleeding of the patient is judged in an early stage, and a basis is provided for early intervention.

The present invention relates to the application of human urokininogenase with single SDS-PAGE electrophoresis strip in serving as active component of medicine composition for treating acute cerebral infarction. The human urokininogenase with single SDS-PAGE electrophoresis strip separated from human urea for the first time has obvious effect of treating acute cerebral infarction. The human urokininogenase of the present invention is normally in the form of medicine composition, such as freeze dried powder for injection or liquid injection.

The invention provides a traditional Chinese medicine formula with an obvious curative effect on cerebral ischemic stroke such as cerebral thrombosis, cerebral infarction and the like. The traditional Chinese medicine formula comprises the following traditional Chinese medicines in parts by mass: 50-150g of raw radix astragali, 3-6g of scorpio, 1-3g of centipede, 6-9g of periostracum cicada, 10-25g of pheretima aspergillum, 9-20g of Chinese polyphaga, 6-10g of leech, 5-10g of gadfly, 5-10g of agkistrodon, 10-30g of rhizoma gastrodiae, 10-15g of radix polygalae, 9-15g of fructus schisandrae chinensis, 9-15g of spina date seed, 10-16g of fructus alpiniae oxyphyllae and other adjuvant drugs. The traditional Chinese medicine formula provided by the invention is suitable for treating cerebral ischemic stroke.

The invention relates to the field of medicines and discloses a pharmaceutical composition and uses thereof. The composition comprises piceatannol 3'-O-glucoside, polydatin and a piceatannol 3'-O-glucoside derivative. Research found that the composition significantly improves the area of cerebral infarction and neurological functions after ischemia-reperfusion, fundamentally improves various damages caused by ischemia for patients with cerebrovascular diseases, has excellent treating functions for cerebrovascular diseases, and has a good clinical application prospect.

The invention discloses a traditional Chinese medicine composition for treating acute cerebral infarction as well as a preparation method and an application of the traditional Chinese medicine composition. The traditional Chinese medicine composition is prepared from 9-15 parts of peach kernel, 9-15 parts of flowers carthami, 6-12 parts of leech, 3-7 parts of scorpio, 9-15 parts of stiff silkworm and 10-20 parts of ligusticum wallichii by mass ratios as raw materials. The specific preparation method comprises the following steps of: weighing each constituent traditional Chinese medicinal material according to the ratio, adding water to decoct and extract, merging and decocting the extracting solution, filtering, concentrating, centrifuging and drying to prepare dry extract. Clinical tests show that the composition disclosed by the invention has the functions of improving the hemarheology of a sufferer, adjusting the blood fat, reducing insulin resistance, improving Chinese medicine symptom integral and improving the efficacy of the clinic treatment, and is expected to prepare the drug preparation for treating acute cerebral infarction with the medicinal prospect.

The invention relates to a preparation method of effective polypeptide components in Vespula insects, and medicinal uses of the effective polypeptide components. The effective components are obtained through a step of dialyzing crude hornet venom through a 30KDa dialysis membrane, and a step of freeze-drying or reduced pressure concentration drying of the above obtained dialysis liquid. A series of pharmacodynamic experiments verify that the effective biotoxin polypeptide components and transdermal absorption preparations thereof can substantially control the cerebral thrombus, can recover the mobility of cerebral palsy animals, can mitigate the ischemic brain injury, have stronger pharmacodynamic performances than first-line medicines comprising plavix, Xingnaojing and the like, and can be expected to be used for preparing innovative biochemical medicines for preventing and treating cardiovascular and cerebrovascular diseases in order to prevent and treat ischemic cardiocardiovascular diseases, such as myocardial infarction, cardiovascular thrombus, cerebral thrombus, cerebral infarction, acute / chronic cerebral apoplexy, and sequelae caused by cerebral infarction injury, like lateral hemiplegia, hemidysesthesia, hemiopia, facial and lingual paralysis, aphasia and general paralysis.

The invention relates to a traditional Chinese medicinal preparation used for treating sequelae of cerebral infarction. The traditional Chinese medicinal preparation used for treating sequelae of cerebral infarction comprises the following raw materials by weight: 60 to 120 parts of milkvetch root, 60 to 120 parts of monkshood, 30 to 60 parts of liquorice root, 6 to 10 parts of Chinese thorowax root, 20 to 30 parts of root of kudzu vine, 6 to 10 parts of bighead atractylodes rhizome, 6 to 10 parts of tall gastrodia tuber, 15 to 20 parts of beautiful sweetgum fruit, 15 to 20 parts of red peony root, 15 to 20 parts of Chinese angelica, 15 to 20 parts of Sichuan lovage rhizome, 18 to 25 parts of earthworm, 6 to 10 parts of peach seeds, 6 to 10 parts of safflower, 15 to 20 parts of bile arisaema, 30 to 40 parts of achyranthcs bidentata blume and 18 to 25 parts of Chinese taxillus herb. The above mentioned raw materials are decocted with water so as to prepare a decoction for oral administration. The traditional Chinese medicinal preparation for treating sequelae of cerebral infarction has a total cure rate of 42% and a total effective rate of 90%, and patients have no dependence on the preparation provided in the invention after curing.

A Chinese medicine for treating hypertension, cerebral arteriosclerosis, cerebral infarction, cerebral thrombus, cerebral haemorrhage, and encaphalatrophy is prepared from 10 Chinese-medicinal materials including red peony root, peach kernel, saffron, black sesame, etc through drying in sum, pulverizing, sieving, baking, mixing, stirring and preparing honeyed pills.

The invention belongs to the field of pharmaceutical chemistry and specially relates to a gamma-cytidine-5 '-triphosphoarginine derivative ester, the preparation method and the application for the same. The invention also provides a preparation method of the gamma-cytidine-5 '-triphosphoarginine derivative ester, and functions of the gamma-cytidine-5 '-triphosphoarginine derivative ester in reversion of an acute cerebral infarction-caused disease process that brain cells are transformed from an ischemia state to a necrosis state, and treatment and improvement of brain cells.

The invention discloses application of serum inflammatory biomarkers in prevention and treatment of acute ischemic cerebral infarction. The biomarkers include at least one cytokine of IL-4, IL-5, IL-6, IL-9, MDC, MIP-1 alpha, sLOX-1, IL-33, Trx and YKL-40. The application of the serum inflammatory biomarkers in the prevention and treatment of the acute ischemic cerebral infarction verifies that the cytokines IL-4, IL-5, IL-6, IL-9, MDC, MIP-1 alpha, sLOX-1, IL-33, Trx and YKL-40 are associated with functional prognosis of the cerebral infarction, the reject ratio of the prognosis of patients with the cerebral infarction can be reduced through the regulation of the cytokines, especially levels of IL-4, IL-5 and MDC, and the application can be used for preventing and treating the acute ischemic cerebral infarction by regulating the serum cytokines and related pathways thereof to predict neural functional prognosis of the patients with the cerebral infarction.

The invention relates to the field of clinical medicine, in particular to an intestinal flora kit for diagnosing cerebral infarction and application thereof. A first reagent is a water-soluble primerwith a gene sequence of 5'-AGAGTTTGATCATGGCTC-3' and 5'-CCGTCAATTCCTTTGAGTTT-3'; a second reagent is a pGEM-T easy vector plasmid; through PCR (polymerase chain reaction)amplification of metabolic specimens, the vector plasmid pGEM-T easy, and transferring into DH5 alpha competent cells, and by exploring an intestinal flora structure of patients with cerebral infarction, the kit provides a new basis for the diagnosis of cerebral infarction, provides possible indications for prevention of cerebral infarction, and has greater social significance and economic benefits.

The invention discloses a compound, a pharmaceutical composition thereof and new application, wherein the new application is the application for preparing medicaments for treating cerebral infarction. The compound can reach very substantial effect for treating cerebral infarction.

The present disclosure relates to a system and a method for estimating an acute cerebral infarction onset time. The method according to the present disclosure includes at least: receiving a first image and a second image of a first patient whose acute cerebral infarction onset time is not identified; extracting an infarction area image from the second image; aligning the second image with the first image; defining an infarction area in the first image, based on a result of the alignment of the second image with the first image; extracting feature information of the first patient, from the infarction area in the first image; comparing the extracted feature information with reference data; and calculating an amount of time that has elapsed since the acute cerebral infarction onset time, based on a result of the comparison of the extracted feature information with reference data.