31 results about "Translation termination" patented technology

Novel 1,2,4-oxadiazole benzoic acid compounds, methods of using and pharmaceutical compositions comprising an 1,2,4-oxadiazole benzoic acid derivative are disclosed. The methods include methods of treating or preventing a disease ameliorated by modulation of premature translation termination or nonsense-mediated mRNA decay, or ameliorating one or more symptoms associated therewith.

Novel hydroxylated 1,2,4-oxadiazole benzoic acid compounds, methods of using and pharmaceutical compositions comprising a hydroxylated 1,2,4-oxadiazole benzoic acid derivative are disclosed. The methods include methods of treating or preventing a disease ameliorated by modulation of premature translation termination or nonsense-mediated mRNA decay, or ameliorating one or more symptoms associated therewith.

In certain embodiments, the disclosure relates to compositions and methods relating to a translation-based gene regulation system that functions in mammalian cells. In certain specific embodiments, the disclosure relates to methods of regulating gene expression via modulating translation termination.

The present invention relates to methods, compounds, and compositions for treating or preventing diseases associated with nonsense mutations in an mRNA by administering the compounds or compositions of the present invention. More particularly, the present invention relates to methods, compounds, and compositions for suppressing premature translation termination associated with a nonsense mutation in an mRNA.

The invention discloses a method for analyzing a structure of a transcriptome gene sequence of a non-model organism. The method comprises the following steps: (1) obtaining an optimal comparison result; (2) determining a protein coding mode and determining a translation termination position; (3) determining a coding starting position of the gene sequence; (4) classifying by utilizing a gene mode; (5) determining a nucleic acid sequence of a coding manner by utilizing a transcriptome sequence and training a nucleic acid sequence mode of a coding protein by utilizing a Markov chain; (6) determining a coding manner of a protein coding sequence of a gene which is not compared. The method disclosed by the invention is used for carrying out high-throughput structural analysis on a lot of gene sequences obtained by transcriptome sequencing of any non-model organism and function annotation of the transcriptome sequence is automatically finished in an analysis process; a Markov model and a support vector machine model are constructed by utilizing a compared high-reliability protein coding nucleic acid sequence, and a gene sequence which is not compared is analyzed, so that the credibility of the structural analysis of the sequence is higher.

Herein is reported a nucleic acid comprising in 5' to 3' direction i) a first nucleic acid fragment encoding a polypeptide of interest without an in frame translational stop codon, ii) a second nucleic acid fragment operably linked to said first nucleic acid fragment which is beginning with the 5' splice donor site of an 5 immunoglobulin heavy chain CH3 or CH4 domain and which is terminated by the3' splice acceptor site of the succeeding immunoglobulin heavy chain transmembrane domain exon M1 and which comprises in frame translational stop codon and a polyadenylation signal, and iii) a thirdnucleic acid fragment operably linked to said second nucleic acid encoding at least a fragment of a transmembrane 10 domain, wherein the second nucleic acid fragment has at its 3' terminus the nucleotide sequence CTACCACCCCCTTCCTGTCCAG (SEQ ID NO: 29) or TGACCACGCCAATCGTGTCCAG (SEQ ID NO: 14) or CTACCACGCCAATCGTGTCCAG (SEQ ID NO: 31).

Novel acetylamino benzoic acid compounds, methods of using and pharmaceutical compositions comprising an acetylamino benzoic acid derivative are disclosed. The methods include methods of treating or preventing a disease ameliorated by modulation of premature translation termination or nonsense-mediated mRNA decay, or ameliorating one or more symptoms associated therewith.