110 results about "Genetically modified canola" patented technology

A canola cultivar designated NQC02CNX21 is disclosed. The invention relates to the seeds of canola cultivar NQC02CNX21, to the plants of canola NQC02CNX21, to plant parts of canola cultivar NQC02CNX21 and to methods for producing a canola plant produced by crossing canola cultivar NQC02CNX21 with itself or with another canola line. The invention also relates to methods for producing a canola plant containing in its genetic material one or more transgenes and to the transgenic canola plants and plant parts produced by those methods. This invention also relates to canola cultivars or breeding cultivars and plant parts derived from canola cultivar NQC02CNX21, to methods for producing other canola cultivars, lines or plant parts derived from canola cultivar NQC02CNX21 and to the canola plants, varieties, and their parts derived from use of those methods. The invention further relates to hybrid canola seeds, plants and plant parts produced by crossing the canola cultivar NQC02CNX21 with another canola cultivar.

A canola cultivar designated NQC02CNX13 is disclosed. The invention relates to the seeds of canola cultivar NQC02CNX13, to the plants of canola NQC02CNX13, to plant parts of canola cultivar NQC02CNX13 and to methods for producing a canola plant produced by crossing canola cultivar NQC02CNX13 with itself or with another canola line. The invention also relates to methods for producing a canola plant containing in its genetic material one or more transgenes and to the transgenic canola plants and plant parts produced by those methods. This invention also relates to canola cultivars or breeding cultivars and plant parts derived from canola cultivar NQC02CNX13, to methods for producing other canola cultivars, lines or plant parts derived from canola cultivar NQC02CNX13 and to the canola plants, varieties, and their parts derived from use of those methods. The invention further relates to hybrid canola seeds, plants and plant parts produced by crossing the canola cultivar NQC02CNX13 with another canola cultivar.

The invention relates to standard molecule simultaneously suitable for specificity detection on seven transgene rape strains. A universal type standard molecule simultaneously suitable for specificity detection on a rape an RT73 strain, an MS1*RF1 strain, an MS1*RF2 strain, an MS8*RF3 strain, a T45 strain, an Oxy235 strain and / or a Topas19 / 2 strain is constructed to carry out verification on the applicability of the standard molecule for qualitative and quantitative detection. The standard molecule is used for highly detecting the specificity of the transgene rape strains.

The invention discloses a method for cultivating high oleic acid rapeseed by means of a gene editing technology, being characterized in that an FAD2 gene is site-directed edit by CRISPR / Cas9 system toobtain transgenic rapeseed plant, and comprising the follow steps: (1) selecting two gRNA target sites of FAD2 gene as S1 and S2 respectively, and synthesizing and construct vector-related primers; (2) constructing a double-target CRISPR / Cas9 gene editing vector; (3). extracting plasmid and transforming Agrobacterium tumefaciens; and (4) using Agrobacterium tumefaciens-mediated transformation totransfer the expression vector into rapeseed, and obtaining the transgenic plants with mutation of FAD2 gene. The oil content of the transgenic rapeseed plant is significantly higher than that of thewild-type rapeseed plant. Moreover, the method provided by the invention has high editing efficiency and good application prospect.

The invention discloses a directional genetically modified method of wild cabbage rape C genome, and the steps include: A. breeding and conversion mediated by wild cabbage agrobacterium tumefaciens: first preparing agrobacterium tumefaciens bacterial solution, next preparing explant, thirdly laying the explant into the agrobacterium tumefaciens bacterial solution for breeding and conversion, fourthly checking resistance of herbicide, and fifthly checking PCR molecule; B. artificially synthesizing genetically modified wild cabbage rape, first artificially synthesizing cabbage cellular genetically modified wild cabbage rape, next artificially synthesizing wild cabbage cellular genetically modified wild cabbage rape, finally performing colorant layer duplication to artificially synthesized haploid rape; C. rating the genetically modified rape. The invention is of simple operation, the accidental purpose gene can be transferred on wild cabbage rape C chromosome with high accuracy, and the obtained genetically modified rape is of small production risk when the environment deactivates in accidentally genetically modified diffusion.

A probe sequence and reagent kit for real-time fluorescent PCR detection of transgenic rapeseed is disclosed. The probe sequence for detecting Barnase gene, the modified CP4-EPSPS gene, the FMV355 promoter of repessed, and the endogenous gene of chloroplast, the maximal, minimal and preferable sequences, and the reagent kit are disclosed for quantitatively and qualitatively detecting the transgenic products. Its advantages are high sensitivity and correctness, high speed, and no cross infection.

The present invention discloses flanking sequence of exogenous event inserting vector for transgenic rape Rf1 and its application, and relates to bioengineering technology. The present invention obtains flanking sequence, SEQ No. 1, of exogenous event inserting vector for transgenic rape Rf1 with transgenic rape Ms1Rf1 as material. Of the flanking sequence, the 1-330 places bases are the same of that of the inserted vector sequence, and the 331-1116 places bases have no homology with that of the inserted vector sequence and are rape genome sequence. The present invention establishes the specific quantitative and qualitative detection method of exogenous event for transgenic rape Rf1 for the other specific event PCR detection of transgenic rape Ms1Rf1.

The invention discloses a 5'UTR sequence of a rape oleosin gene and an application of the 5'UTR sequence in the gene targeting expression. The 5'UTR sequence of the oleosin gene is one of the following nucleotide sequences: 1, a DNA sequence represented by SEQ ID NO:1 in a sequence table; and 2, a nucleotide sequence which can be hybridized with the DNA sequence limited by the SEQ ID NO:1 in the sequence table under highly strict conditions. The sequence represented by SEQ ID NO:1 and other elements construct a plant expression vector pGOT which comprises the following four complete expression boxes: a P35S-codA-Tnos expression box, a 1900bp rape oleosin gene 5'UTR-"sesame oleosin + CT fusion protein gene"-Pnos-NPTII-Tnos expression box, a rape oleosin gene 3'DNA sequence expression box, and a P35S-codA-Tnos expression box. Transgenic rape plants and lines are obtained through an in planta method. According to the invention, a gene targeting technology is utilized to insert an exogenous target gene into the 3' terminus of the oleosin gene, so the expression of the exogenous gene in plants is greatly improved, and a new platform is established for the massive production of a medicinal protein with a bioreactor.

A process and reagent kit for quantitatively detecting the transgenic component content in transgenic rape seed and its products are disclosed. Said process includes extracting DNA, PCR amplification by use of extracted DNA as template, PEP-specific primer pair and exogenous gene specific primer pair, using the amplified resultants to respectively hybridize with the first and the second probes, detecting the detectable signals generated by hybridization, and analyzing the detected data. Its advantages are high correctness and simple operation.

The present invention discloses flanking sequence of exogenous event inserting vector for transgenic rape Ms8 and its application, and relates to bioengineering technology. The present invention obtains flanking sequence, SEQ No. 1, of exogenous event inserting vector for transgenic rape Ms8 with transgenic rape Ms8Rf3 as material and primer pair MDB201, 5'GCTTGGACTATAATACCTGAC 3' and VDS57, 5' GCATGATCTGCTCGGGATGGC 3', and through PCR amplification. The present invention designs primers Ms8RG, 5'CCTTGAGGACGCTTTGATCATATT 3' and Ms8RV, 5'CCTTTTCTTATCGACCATGTACTC 3' and TaqMan probe Ms8RP, 5'FAM-CCGAGTTCGACGGCCGAGTACTG-TAMRA 3'; and establishes the specific quantitative and qualitative detection method of exogenous event inserting vector for transgenic rape Ms8. The present invention is suitable for specific PCR detection of other Ms8Rf3 event.

The invention discloses design and application of a positive plasmid molecule pYCID-1905 for identifying transgenic rape and product transformants thereof, and relates to security supervision of the transgenic rape and a transformant identification technique in the field of transgenic security. The base sequence of the pYCID-1905 is as shown in SEQID NO.1. The pYCID-1905 is used as a positive control and quality control sample, ordinary PCR and real-time fluorescence PCR identification detection of transformants can be performed on rape and products thereof, and the coverage rate of approved transgenic rape varieties and transgenic rape varieties to be approved in China is 100%. According to the design and the application disclosed by the invention, the technical difficult problem that positive control or standard products lack in transgenic rape transformant identification and detection is solved, the problem of positive control set for each detection target during variety identification and detection is solved, and human resource cost and economic cost for preparing each rape transformant positive control are reduced.

The invention belongs to the field of plant genetic engineering and particularly relates to an intermediate factor BnMED16 gene to regulate Sclerotinia stem rot resistance in Brassica napus and application thereof. A gene BnMEDIATOR16(BnMED16 to control Sclerotinia stem rot in Brassica napus is acquired from Brassica napus westar by isolating and cloning; a nucleotide sequence of the gene is shownas SEQ ID NO: 1; a protein sequence encoded by the gene is shown as SEQ ID NO: 2. Functional verification is performed on the gene BnMED16 herein. By increasing the expression quantity of BnMED1 in Brassica napus through genetic engineering techniques, it is possible to activate a disease-resistant signal pathway of jasmonic acid and to increase accumulation of active oxygen and expression of disease resistance-related genes; lesion area of leaf Sclerotinia stem rot of transgenic oilseed rape is decreased by 81.20%; the oilseed rape is more resistant to Sclerotinia stem rot. The gene herein has an important application prospect in enhancing the resistance of Brassica napus to Sclerotinia stem rot.

The present invention discloses the guide object sequence and reagent box used for real-time PCR inspection of transgenic rapeseed SYBR Green, providing the guide object sequence for the inspection of extraneous structure gene of transgenic rapeseed RT73 system, extraneous structure gene of MS8 system and endogenous gene of FatA, as well as the maxima, minima and optima selection sequence and the reagent box produced in accordance with guide object sequence. The present technology is used for qualitative and quantitative inspection of transgenic product and has the advantages of high resolution and avoiding cross pollution causing pseudo-positive reaction. SYBR Green real-time PCR technology employs complete closed-tube method, and PCR post treatment is not needed, avoiding cross pollution causing pseudo-positive reaction. SYBR Green dye is also very stable at the extreme temperature demanded by PCR reaction, which can efficiently distinguish specific product, nonspecific product and guide object dipolymer to compensate its bad specificity. The inspection technology is fast, sensitive, simple in operation, time saving and energy saving, accurate and reliable.

The invention discloses a method of screening transgene cole through dipping seeds into kanamycin solution. The cole seeds having undergone transgene processing are dipped into the 0.18-0.30 percent kanamycin solution for processing for 12-24 hours and then are sowed in the soil which does not contain kanamycin, and the green seedlings growing normally are screened as the transgene plants after 2-3 days. The method of screening transgene cole is applicable to screening of a large amount of transgene cole seeds with simplicity, quickness, high efficiency, and reliability.

The invention relates to a reference molecule for specifically detecting a genetically modified rapeseed RT73 and application of the reference molecule. The reference molecule which is suitable for specific detection of a genetically modified rapeseed RT73 strain is constructed, and contains an exogenous interpose fragment of the genetically modified rapeseed RT73 strain, a 3' terminal adjacent area sequence of genomic deoxyribonucleic acid (DNA) of rape, and HMG and PEP fragments of an endogenous reference gene of the rape. The reference molecule has high specificity on the detection of the genetically modified rapeseed RT73 strain.

The invention discloses a multiplex real-time fluorescence quantitative PCR detection kit for transgenic rapeseed RF1, Oxy235 and RF3 and an application thereof. The detection kit comprises the following primers and probes: CruA-F / R, CruA-Probe, RF1-F / R, RF1-Probe, Oxy235-F / R, Oxy235-Probe, RF3-F / R and RF3-Probe. By extracting the DNA of the sample to be tested as a template, the primers and probes are added, the real-time fluorescence quantitative PCR detection is conducted, and whether the test samples contain the RF1, Oxy235 or RF3 transformant components is judged according to the markers on the probes, the Ct value and an expected amplification curve. According to the multiplex real-time fluorescence quantitative PCR detection kit, the qualitative and quantitative detection of the rapeseed internal standard gene and 3 kinds of transgenic rapeseed strains can be rapidly and accurately achieved through only one PCR reaction; the PCR detection kit has the advantages of low cost and high flux.

The invention belongs to the fields of plant molecular breeding and biotechnology and discloses application of a PLD alpha1 gene in aspects of increasing crop drought resistance and seed production. The nucleotide sequence of the PLD alpha1 gene is shown as SEQ ID NO:1, or the similarity of the nucleotide sequence of the PLD alpha1 gene is more than or equal to 70% compared with the nucleotide sequence shown as SEQ ID NO:1. The invention also discloses a method for increasing rape drought resistance and rape seed production. Experiments show that rape with stoma-specific overexpressed AtPLDalpha1 can effectively regulate stomas of plants to be closed under drought stress, so that moisture transpiration of leaves is reduced, and the water retaining capacity and the drought resistance of the plants are improved; the genetically modified rape plant has the characteristics that the flowering phase is postponed, vegetative growth is vigorous, the silique quantity is high, and the main inflorescence and the plant height of the rape are remarkably higher than those of the wild type rape when being suffered from an arid season in an early phase or an intermediate phase under a natural growth condition in the fields.

The invention provides a method for realizing targeting substitution by comprehensively using specific expression and gene targeting of plant oleosin and for ultrahigh-level expression of salmon calcitonin protein in transgenic rapeseeds. According to the invention, rape 5' UTR sequence is obtained by cloning 1900 bp with Race; an inherent endogenous sequence in the genome of rape is substituted by 5' UTR sequence of rape oleosin gene--sesame oleosin gene+CT fusion protein gene'--Pnos-NPTII-Tnos--3' UTR sequence of rape oleosin gene; a transgenic rape plant and a transgenic rape line are obtained by using the method of inplanta. According to detection results, the endogenous sequence in the genome of rape is substituted by a new sequence, which enables targeting expression of a target gene to be successfully realized and ultrahigh-level expression of salmon calcitonin protein in transgenic rapeseeds to be achieved. The method has the following remarkable advantages: the expression level of target protein is high, and the expressed protein is easy to store and purify.

An application of rape iMyAP gene over-expression in the sclerotinia sclerotiorum resistance of rape is that the complete coding sequence with intron of the iMyAP gene, which is directly cloned from the DNA of the rape genome through high-fidelity polymerase chain reaction (PCR), or the full-length CDS of the iMyAP gene, which is amplified from rape through the reverse transcription-polymerase chain reaction (RT-PCR) technology, is inserted behind the over-expression promoter to obtain an over-expression vector, and then the vector is introduced in the rape genome to obtain genetically modified rape. Therefore, the over-expression of the iMyAP gene in the genetically modified plant can be realized, the rape can be in a defense system priming state and the rape can have high sclerotinia sclerotiorum resistance, which has great significance for protecting high and stable rape yield.

The present invention discloses left boundary flanking sequence of exogenous event inserting vector for transgenic rape Oxy-235 and its application, and relates to bioengineering technology. The present invention obtains left boundary flanking sequence, SEQ No. 1, of exogenous event inserting vector for transgenic rape Oxy-235 with transgenic rape Oxy-235 as material. Of the left boundary flanking sequence, the 1-831 places bases are the same of that of the inserted vector sequence, and the 832-923 places bases have no homology with that of the inserted vector sequence and are rape genome sequence. The present invention establishes the specific quantitative and qualitative detection method of exogenous event for transgenic rape Oxy-235 for the other specific event PCR detection of transgenic rape Oxy-235.

The present invention discloses left boundary flanking sequence of exogenous event inserting vector for transgenic rape T45 and its application. The present invention obtains left boundary flanking sequence, SEQ No. 1, of exogenous event inserting vector for transgenic rape T45 with transgenic rape T45 as material. Of the left boundary flanking sequence, the 1-255 places bases are the same of that of the inserted vector sequence, and the 256-2154 places bases have no homology with that of the inserted vector sequence and are rape genome sequence. The present invention establishes the specific quantitative and qualitative detection method of exogenous event for transgenic rape T45 for the other specific event PCR detection of transgenic rape T45.

The invention discloses design for screening positive plasmid molecule pYCSC-1905 on transgenic oilseed rape and a product thereof and application of the design, and relates to a safety supervision and screening detection technology of the transgenic oilseed rape in the field of transgenic safety. The base sequence of the pYCSC-1905 is as shown in SEQ ID NO. 1. The pYCSC-1905 is used as a positivecontrol and quality control sample, common PCR and real-time fluorescent PCR screening detection of transgenic ingredients on the oilseed rape and product thereof can be carried out, and the coveragerate on transgenic oilseed rape with known genetic information at present is 100%; according to the invention, the technical problem of lack of positive controls or standard substances in transgenicoilseed rape screening detection is solved, the problem that multiple positive controls are set for multiple detection targets in screening detection is avoided, and the labor cost and economic cost for preparing multiple positive controls are reduced.

The production process of transgenic rape as sinapic acid bioreactor includes the steps of: cloning phosphoenolpyruvate carboxyilase gene PEP segment and constituting it into Anti-PEG gene plant expression vector, introducing Anti-PEP gene into rape genome through gene conversion process to obtain "high-oil rape" with efficient oil synthesizing rape seed; preparing lytic phosphatidic acid acyltransferase (LPAAT) gene capable of connecting sinapic acid to the sn-2 site of 3-glycerol phosphate and connecting it to plant expression vector promoter to constitute LPAAT gene plant expression vector; introducing LPAAT gene into rape genome to obtain "high-sinapic acid rape" with efficient sinapic acid and 3-glycerol phosphate combining seed; crossbreeding "high-oil rape" and "high-sinapic acid rape" to obtain F1 generation rape plant with both "high-oil rape" characteristic and "high-sinapic acid rape" characteristic.

The present invention discloses one kind of rape pyruvic dehydrogenase kinase gene and its application in rape, and relates to gene engineering technology. The gene has nucleotide sequence coding the protein kinase catalysis area and mitochondrion locating sequence SEQ ID No. 1. The application of the gene in rape includes: 1. providing one kind of vector including proper promoter and translation controlling part; 2. providing one kind of host bacteria capable of being expressed in plant; 3. providing one method of introducing the vector to the plant cell; 4. providing one kind of plant transformed with the vector containing pyruvic dehydrogenase kinase gene; and 5. providing one transgenic rape capable of inhibiting the expression of rape pyruvic dehydrogenase kinase gene. The transgenic rape exhibits early blooming character, shortened growth period, and increased seed yield and oil bearing rate.

The present invention discloses flanking sequence of exogenous event inserting vector for transgenic rape Topas 19 / 2 and its application, and relates to bioengineering technology. The present invention obtains flanking sequence, SEQ No. 1, of exogenous event inserting vector for transgenic rape Topas 19 / 2 with transgenic rape Oxy-235 as material, GenomeWalker of Invitrogen co. for constituting genomic library, and primer pair TOPLB-1 and TOPLB-2, and the jointing primer, and through PCR amplification. The present invention designs primers TOPLG and TOPLV and TaqMan probe TOPLP; and establishes the specific quantitative and qualitative detection method of exogenous event for transgenic rape Topas 19 / 2. The present invention is suitable for specific PCR detection of other Topas 19 / 2 events.

The present invention discloses flanking sequence of exogenous event inserting vector for transgenic rape Ms1 and its application, and relates to bioengineering technology. The present invention obtains flanking sequence, SEQ No. 1, of exogenous event inserting vector for transgenic rape Ms1 with transgenic rape Ms1Rf1 as material. Of the flanking sequence, the 1-330 places bases are the same of that of the inserted vector sequence, and the 331-2446 places bases have no homology with that of the inserted vector sequence and are rape genome sequence. The present invention establishes the specific quantitative and qualitative detection method of exogenous event for transgenic rape Ms1 for the other specific event PCR detection of transgenic rape Ms1Rf1 and Ms1Rf2.

The invention discloses a Chinese white poplar lignin monomer synthesis gene 4-CL and an application thereof. The gene is responsible to catalyzing each cinnamic acid and each corresponding coenzyme A ester generated by derivative thereof, the synthesis of each downstream secondary product is participated, and the gene is the essential gene of controlling the lignin synthesis. The findings indicates that the infection of the plant resistance pathogen is reinforced through the increase of the lignin content, the rape stem strength is enhanced, and thus the lodging resistance is obviously enhanced. The concrete result shows that the lignin content of the transgenic rape increases over 10 percents than the acceptor compared with the lignin content; the transgenic plant leaf reduces about 30 percents than the acceptor compared with the disease spots expanding area; and the cane strength of the transgenic plant comparably increases about 20 percents.