Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Standard molecule simultaneously suitable for specificity detection on seven transgene rape strains

A specific, transgenic technology applied in the biological field

Active Publication Date: 2011-10-12
SHANGHAI ENTRY EXIT INSPECTION & QUARANTINE BUREAU OF P R C
View PDF8 Cites 16 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

So far, there has been no report on constructing standard molecules from the exogenous genes of the above seven transgenic rapeseed lines

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Standard molecule simultaneously suitable for specificity detection on seven transgene rape strains
  • Standard molecule simultaneously suitable for specificity detection on seven transgene rape strains
  • Standard molecule simultaneously suitable for specificity detection on seven transgene rape strains

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0150] Embodiment 1, standard molecular construction

[0151] In order to construct general standard molecules suitable for the specific detection of transgenic rapeseed RT73, MS1×RF1, MS1×RF2, MS8×RF3, T45, Oxy235 and Topas19 / 2 lines, MS1-5, RT73-3, RF3-3, RF3 -5, MS8-3, MS8-5, Oxy235-5, Oxy235-3, RF1-5, T45-5, Topas19 / 2-3, RF2-5, HMG, PEP and other 14 specific sequence fragments were gradually cloned into In the pEASY-T3 vector, pCanola9 ( figure 1 ), the size is about 7921bp. The results of three times of plasmid whole gene sequencing were consistent with the target sequence.

[0152] MS1-5 (SEQ ID NO: 1, 299bp):

[0153] GGCCTGTGGTCTCAAAGATGGATCATTAATTTCCACCTTCACCTACGATGGGGGGCATCGCACCGGTGAGTAATATTGTACGGCTAAGAGCGAATTTGGCC TGTAGACCTCAATTGCGAGCTTTCTAATTCAAACTATTCGGGCCTAACTTTTGGTGTGATGATGCTGAAGAACCTATCCATGAAACTCACAAAAACATC

[0154] RT73-3 (SEQ ID NO: 2, 316bp):

[0155] CGACGGATCGTAATTTGTCGTTTTATCAAAATGTACTTTCATTTTATAATAACGCTGCGGACATCTACATTTTTGAATTGAAAAAGAATTGGTAATTACTCTT...

Embodiment 2

[0182] Embodiment 2, standard molecule is used for the applicability identification of ordinary PCR detection

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to standard molecule simultaneously suitable for specificity detection on seven transgene rape strains. A universal type standard molecule simultaneously suitable for specificity detection on a rape an RT73 strain, an MS1*RF1 strain, an MS1*RF2 strain, an MS8*RF3 strain, a T45 strain, an Oxy235 strain and / or a Topas19 / 2 strain is constructed to carry out verification on the applicability of the standard molecule for qualitative and quantitative detection. The standard molecule is used for highly detecting the specificity of the transgene rape strains.

Description

technical field [0001] The invention belongs to the field of biotechnology; more specifically, the invention relates to a standard molecule suitable for the specific detection of seven transgenic rapeseed lines at the same time. Background technique [0002] In recent years, genetically modified organism technology has been widely used in agricultural production. Countries around the world are constantly improving the research on detection methods of genetically modified organisms and strengthening the safety supervision of genetically modified raw materials and their products. Among them, nucleic acid detection technology has become the most important and commonly used method for the detection of genetically modified organisms. Under the existing technical conditions, the exogenous gene is inserted into the crop genome in a random manner, so the boundary sequence between the exogenous insertion fragment and the DNA binding site of the crop genome in each transgenic crop var...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/63C12Q1/68
Inventor 李想潘良文吕蓉高琴刘月明张舒亚
Owner SHANGHAI ENTRY EXIT INSPECTION & QUARANTINE BUREAU OF P R C
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More