Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Flanking sequence of exogenous event inserting vector for transgenic rape Ms8 and its application

A technology of exogenous insertion and flanking sequences, which is applied in the fields of application, genetic engineering, plant gene improvement, etc., and can solve the problems of specificity and characterization that have not yet been discovered

Inactive Publication Date: 2007-08-22
INST OF OIL CROPS RES CHINESE ACAD OF AGRI SCI
View PDF0 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0010] After searching the existing patents and other literatures, no report has been found on the side sequence of the transgenic rape Ms8 event inserted into the vector and the use of this sequence to establish event-specific qualitative and quantitative PCR (polymerase chain reaction) detection

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Flanking sequence of exogenous event inserting vector for transgenic rape Ms8 and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0041] 1. PCR amplification of the flanking sequence of the transgenic rapeseed Ms8 event exogenous insertion vector

[0042] First preheat 20% SDS to 65°C, take 15ml SDS extraction buffer (0.1TrisHCl, 0.05MEDTA, 1M NaCl pH8.0) and add it to a 50ml centrifuge tube, then add 2.5μl β-mercaptoethanol, mix well; grind with liquid nitrogen About 3g of leaves, transfer the powder to 50ml of 50ml centrifuge tube containing extraction buffer, shake and mix on the shaker, add 2ml of preheated 20% SDS, mix well, 65 ℃ water bath for at least 30 minutes, during which it should be light Shake the test tube gently; after the water bath, quickly place the centrifuge tube on ice, add 3ml 3M KAc, mix well, and place on ice for 30 minutes; centrifuge at 5000g at 4°C for 5min; transfer the supernatant to a new 50ml centrifuge tube, add 2 / 3 volume of isopropanol, mix well, place at -20°C for more than 30min; centrifuge at 6000g, 4°C for 15min, pour off the supernatant, wash with 75% ethanol, dry ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention discloses flanking sequence of exogenous event inserting vector for transgenic rape Ms8 and its application, and relates to bioengineering technology. The present invention obtains flanking sequence, SEQ No. 1, of exogenous event inserting vector for transgenic rape Ms8 with transgenic rape Ms8Rf3 as material and primer pair MDB201, 5'GCTTGGACTATAATACCTGAC 3' and VDS57, 5' GCATGATCTGCTCGGGATGGC 3', and through PCR amplification. The present invention designs primers Ms8RG, 5'CCTTGAGGACGCTTTGATCATATT 3' and Ms8RV, 5'CCTTTTCTTATCGACCATGTACTC 3' and TaqMan probe Ms8RP, 5'FAM-CCGAGTTCGACGGCCGAGTACTG-TAMRA 3'; and establishes the specific quantitative and qualitative detection method of exogenous event inserting vector for transgenic rape Ms8. The present invention is suitable for specific PCR detection of other Ms8Rf3 event.

Description

technical field [0001] The invention relates to the detection of transgenic rapeseed in the technical field of bioengineering, in particular to a side sequence of an exogenous insertion vector of transgenic rapeseed exogenous gene integration event Ms8 and its application. Background technique [0002] In recent years, genetically modified crops such as corn, soybean, cotton, rapeseed and tomato have been approved to be planted and produced in many countries, and some have been processed into food, feed or used as food additives. Since the ecological safety and food safety of genetically modified products have been controversial, more than 30 countries and regions have successively implemented genetically modified product labeling systems. [0003] According to the sequence information of the exogenous gene in the transgenic product, the combination of the exogenous gene on the transgenic construct, and the integration site of the construct on the genome, gene-specific, vect...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/82C12N15/29C12N15/65C12Q1/68
Inventor 卢长明吴刚武玉花肖玲
Owner INST OF OIL CROPS RES CHINESE ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com