42 results about "Dna barcodes" patented technology

The invention provides a method and a PCR (polymerase chain reaction) reagent kit for identifying DNA (deoxyribonucleic acid) barcodes of animal medicinal materials. The PCR reagent kit comprises PCR enhancers. The PCR enhancers comprise bovine serum albumin, dithiothreitol, betaine and nonidet p40. The method and the PCR reagent kit for identifying the DNA barcodes of the animal medicinal materials have the advantages that low-abundance traditional Chinese medicine samples with difficulty in amplification, particularly, samples with difficulty in identifying DNA barcodes, such as samples of buffalo horns, antelope horns, tortoise shells, carapax trionycis, pangolins and snake slough, can be effectively amplified, accordingly, the amplification success rate which is close to 100%, of DNA barcode identification techniques can be guaranteed, and DNA barcode techniques can be widely applied.

A method for detecting a target biological material using DNA barcodes is provided. The method is for detecting a target biological material (e.g., DNA) by using DNA barcodes by which a trace amount of target biological material can be detected in a rapid and economic manner without performing polymerase chain reaction (PCR). The method is characterized by the use of magnetic particles and polymer particles coated with DNA barcodes to sense a trace amount of a biological material (e.g., DNA).

The invention provides substrates that have antibodies and aptamers bound thereto. The invention also provides methods of detecting target analytes in a sample comprising detecting binding of a target analyte to capture probes on a substrate, wherein some of the capture probes comprise antibodies and other capture probes comprise aptamers, and all of the capture probes are bound to the substrate. In addition, the invention provides substrates that have capture probes and capture oligonucleotides bound thereto, wherein the capture oligonucleotides can hybridize to DNA barcodes. The invention also provides methods of detecting target analytes in a sample comprising contacting the sample with a substrate that has capture probes and capture oligonucleotides bound thereto.

A method for detecting a target biological material using DNA barcodes is provided. The method comprises: attaching a first type of probes to the surface of magnetic particles to prepare magnetic particles for isolation wherein the first type of probes are at least partially complementary to a target biological material of interest; attaching a second type of probes to the surface of polymer particles to prepare polymer particles for analysis wherein the second type of probes are at least partially complementary to the target material but are different from the first type of probes, and attaching DNA barcodes as identification codes to the surface of the polymer particles wherein the DNA barcodes are present in an amount at least three times the amount of the second type of probes, have a predetermined sequence and are labeled with a label material; reacting the magnetic particles for isolation, the polymer particles for analysis and the target material in a hybridization reaction buffer to prepare composites, each of which consists of one magnetic particle for isolation, the target material and one polymer particle for analysis; separating the composites from unreacted reactants using a magnetic separator; heating the separated composites to denature the DNA barcodes present in the polymer particles for analysis and removing the magnetic particles for isolation and the polymer particles for analysis from the composites by centrifugation to isolate the DNA barcodes; and detecting a signal generated from the label material bound to the isolated DNA barcodes.

The invention belongs to the technical field of traditional Chinese medicine and Chinese herbal medicine identification and relates to a specific primer for identifying bungarus parvus based on DNA barcodes, a PCR method and a kit, which is used for identifying the authenticity of the bungarus parvus. The method comprises the following steps: extracting DNA, performing specific PCR amplification, and performing electrophoresis detection. The specific primer is simple, convenient and quick, high in specificity, good in commonality and the like. The specific primer is used for identifying the bungarus parvus and medicinal materials, and is especially suitable for quick identification of processed drug preparations containing the bungarus parvus due to relatively short target fragments.

The invention provides a new combination of two pairs of universal amplification primers for plant parasitic nematode ribosome ITS (internal transcribed spacer) and an application method thereof for PCR (polymerase chain reaction) amplification. The key innovation point of the method is that after the new primer combination is applied to the PCR amplification of the plant parasitic nematode ITS, the plant nematode type which can be amplified by the new PCR amplification system has broader spectrum, the amplification efficiency and success rate are remarkably improved, and the problems of the ITS amplification in the plant nematode identification before are effectively solved. The PCR amplification product amplified by the method provided by the invention meets the needs of the molecular detection technologies such as nematode DNA (deoxyribonucleic acid) barcode identification and RFLP (restricted fragment length polymorphism) enzyme digestion identification, and can be popularized to the quarantine identification of the port and agriculture / forestry departments in China.

The invention discloses an application of trnH-psbA sequences as DNA barcodes in identifying Trapa acornis Nakano and an identifying method. The identifying method comprises the following steps: amplifying trnH-psbA sequences of to-be-detected samples by using PCR (polymerase chain reaction) and sequencing, if a 278bp base of the trnH-psbA sequence is A and a 308bp base is T, determining that the to-be-detected samples are Trapa acornis Nakano. Compared with the traditional morphological identification method and DNA fingerprint marking, in the invention, trnH-psbA sequences can be used as DNA barcodes for identifying Trapa acornis Nakano, so that through carrying out PCR amplification and sequencing on the trnH-psbA sequences, identification results can be directly obtained, and the identifying method is high in detection accuracy, high in repeatability and short in identification time.

The invention provides a lysis solution for plant parasitic nematode genome DNA micro-extraction and application of the lysis solution. The lysis solution is characterized by being allowed to be directly used for plant parasitic nematode genome DNA micro-extraction without cutting, extruding and breaking, grinding and freezing and thawing nematodes, operation steps are simpler and more convenient to implement, and sample pollution and loss are reduced to the maximum degree in the DNA extraction process, extraction efficiency is obviously improved, the success rate is obviously increased, and the problems that in the prior art, efficiency is low, stability is poor, operation is difficult and the steps are numerous in the plant parasitic nematode DNA extraction process are solved effectively. Nematode DNA obtained through extraction by the adoption of the method meets the requirements of plant parasitic nematode DNA barcode identification, RFLP enzyme digestion identification, specific primer PCR identification and other molecular detection technologies, and the lysis solution can be applied and popularized in quarantine identification work of China ports, agricultural departments and forestry departments.

The invention discloses a method for identifying DNA (Deoxyribose Nucleic Acid) barcodes of three gentiana macrophylla medicinal materials in the pharmacopeia. Three gentian macrophylla medicinal materials in the pharmacopeia are respectively Gentiana macrophylla Pall, G.crassicaulis Duthie, and G.straminea Maxim. The identification method comprises two steps of carrying out DNA extraction and splicing obtained DNA sequences, wherein in the DNA extraction step, a good extraction effect is obtained by prolonging cracking heating time and utilizing phenol and trichloromethane, between which the volume ratio is 1:1, to remove interference of phenol and polysaccharide substances; then the obtained DNA sequences are spliced to identify gentiana macrophylla so as to obtain a good identifying effect.

The invention discloses a big data based identification method for an aconitum transsectum DNA barcode and aconitum transsectum, belonging to the technical field of molecular identification. By extensively investigating data information of field distribution areas, main cultivation areas, field sympatric species and closely related medicinal species, and then sampling in as many places as possibleto create a big database for DNA barcodes of samples, sequence information sites unique to aconitum transsectum are compared and found, and then the DNA barcode which can be used for identification unique to the aconitum transsectum is further obtained. The DNA barcode is a sequence with a total length of 443bp obtained by amplification of primer sequences SEQ ID NO. 1 and SEQ ID NO. 2, wherein 106-112bp is basic ACTAAGA, and 201-210bp is basic CCTATCTATA. The utilization of the DNA barcode can be greatly beneficial to the rapid identification of the medicinal plant aconitum transsectum.

The invention discloses a bacterial nucleic acid sequencing and identification system and method for intelligent DNA barcodes, and relates to the technical field of DNA sequencing and identification.Through the system and method, technical research on the DNA barcode database and detection and identification traceability thereof of food poisoning sources can be conveniently realized, so that foodsafety can be guaranteed, the meal selection of people can be guided, the occurrence of poisoning events can be prevented, and as the nucleic acid sequencing identification method of common bacteriais established, convenient DNA barcode sequencing and identification of bacteria, cells and viruses in the biological field can be achieved; operation can be performed on a DNA genome in a special wayduring extraction and purification, so that the dissociation of a DNA sequence can be avoided. Through the adoption of a constructed standard nucleic acid sequence, a standard nucleic acid sequence database for bacterial nucleic acid sequencing and identification can be input according to a unified common description and normative codes, so that objective and accurate judgment bases can be provided for the nucleic acid sequencing identification method.

Provided is a method for extracting and characterizing molecular clones. The method includes: providing a substrate on which molecular clones are formed; applying energy to desired ones of the molecular clones in a non-contact mode to extract the desired molecular clones from the substrate; chemically linking DNA barcodes to the sequences of the extracted molecular clones; and determining the DNA barcode-linked sequences by parallel sequencing.

The invention discloses a molecular identification primer, kit and method for five groupers. The invention firstly provides the molecular identification primer for five groupers. The nucleotide sequence of the primer is as shown in SEQ ID NO: 1-2; and the five groupers are any one or more of Yunlong hybrid spot, tiger dragon hybrid spot, red dragon hybrid spot, epinephelus akaara or epinephelus coioides. By utilizing the primer, the five groupers can be quickly and effectively identified by adopting a method of combining mitochondrial genome DNA barcodes and a restriction endonuclease technology, and the primers are stable in reaction and good in repeatability; compared with the traditional morphological identification, the method has the characteristics of high detection accuracy and objectivity; compared with a simple mitochondrial genome DNA bar code sequencing identification method, the method has the characteristics of strong intuition and simple judgment; and therefore, the primer provided by the invention has a wide application prospect in identifying the five groupers or preparing a kit for identifying the five groupers.

The invention relates to a DNA (deoxyribonucleic acid)-barcode-based eel species identification method, in particular to a DNA-barcode-based species identification method for anguilla japonica, anguilla rostrata and auguilla anguilla. The method comprises the following steps of performing eel DNA extraction, performing PCR (polymerase chain reaction) amplification to obtain a 244bp product by utilizing DNA barcode primers, and performing species identification according to nucleotide sequence characteristic variation sites of the species, wherein the DNA barcode primers are EEL244-F:CCTGTTCC TCGTGGGGGC TTTT and EEL244-R:ATGGCATAACGAGGGTTTAACTG. The method is low in time consumption, simple and convenient to operate and high in specificity, and can be used for identifying common processed eel products such as roasted eel which cannot be morphologically identified, and technical support is provided for the maintenance of enterprises and consumer benefits and normal market order.

The invention discloses a leptobotia elongate DNA barcode sequence and an application thereof and belongs to the technical field of species identification. The leptobotia elongate DNA barcodes refer to leptobotia elongate COI genes, the DNA barcode sequence can serve as a standard detection sequence of leptobotia elongate DNA, and endemic species of the leptobotia elongate can be effectively identified.

Disclosed herein include systems, methods, compositions, and kits for in situ readout of barcodes, such as DNA barcodes. Barcode constructs containing a promoter (e.g., a phage promoter) that is inactive in live cells can be integrated in the genomes of cells. Cells can be fixed, and phage RNA polymerase can be used for transcription of the barcode to RNA transcripts. The RNA transcripts can be detected using, for example, fluorescent imaging and used to determine barcode sequences.

The invention belongs to the field of identification of species and strains, and in particular relates to a DNA barcode primer composition, a DNA barcode composition, a kit, a method and an application for identifying Arthrospora adenorivorum strains. The DNA barcode composition of the present invention comprises a first DNA barcode as shown in SEQ ID No.1, a second DNA barcode as shown in SEQ ID No.2, and a third DNA as shown in SEQ ID No.3 A barcode, wherein the first, second and third DNA barcodes are derived from the genome of Arthrospora adenovora TMCC 70007 strain. The DNA barcode can accurately identify the Pu-erh tea fermentation strain Arthrospora adenorivorum TMCC 70007, and can quickly and accurately identify the strain from confusing strains or other strains within the same species.

Provided is a molecular clone extracting and verifying method which comprises the steps of: providing a substrate on which molecular clones are formed; applying energy in a contactless manner to desired molecular clones from among the molecular clones and extracting the desired molecular clones from the substrate; chemically linking DNA barcodes and base sequences of the extracted molecular clones; and analyzing the base sequences, to which the DNA barcodes have been linked, through a parallel sequencing analysis technique.

The invention belongs to the field of identification of species and strains, and in particular relates to a DNA barcode primer composition, a DNA barcode composition, a kit, a method and an application for identifying Arthrospora adenovoransus strains. The DNA barcode composition of the present invention comprises a first DNA barcode as shown in SEQ ID No.1, a second DNA barcode as shown in SEQ ID No.2, and a third DNA barcode as shown in SEQ ID No.3 , and the fourth DNA barcode as shown in SEQ ID No.4, wherein the first, second, third and fourth DNA barcodes are derived from the genome of Arthrospora adenovora TMCC 70007 strain. The DNA barcode can quickly identify the Pu-erh tea fermentation strain Arthrospora adenorivorum TMCC 70007, and can quickly and accurately identify the strain from confusing strains or other strains within the same species.

The invention discloses a method for identifying DNA (Deoxyribose Nucleic Acid) barcodes of three gentiana macrophylla medicinal materials in the pharmacopeia. Three gentian macrophylla medicinal materials in the pharmacopeia are respectively Gentiana macrophylla Pall, G.crassicaulis Duthie, and G.straminea Maxim. The identification method comprises two steps of carrying out DNA extraction and splicing obtained DNA sequences, wherein in the DNA extraction step, a good extraction effect is obtained by prolonging cracking heating time and utilizing phenol and trichloromethane, between which the volume ratio is 1:1, to remove interference of phenol and polysaccharide substances; then the obtained DNA sequences are spliced to identify gentiana macrophylla so as to obtain a good identifying effect.

The invention belongs to the technical field of algae molecular markers, and in particular relates to a pair of primers for identifying DNA barcodes of Enteromorpha close relatives, a DNA barcode, and an application and detection method thereof. The primer pair for identifying the relative species of Enteromorpha, the upstream primer sequence: 5'GCTGACATACCATCACGATAGT 3'(SEQ ID U01); the downstream primer sequence: 5'CGTATTATTTTCACCAGACCTT 3'(SEQ ID U02). Application of the primer pair in identification of related species of Enteromorpha. The invention is a strong supplement to the traditional species identification, and the sample identification process can be automated and standardized, breaking through the over-reliance on experience, and can use the fragments of algae to carry out rapid and effective identification, and can establish and form in a short period of time. Easy-to-use application system.

The invention discloses a set of Mini-Barcoding primers for obtaining DNA barcode sequences of beetle specimens in collections, consisting of primer pairs Cocc301, Cocc286 and Cocc214 or primer pairs Cocc301 and Cocc413 or primer pairs Cocc301, Cocc286, Cocc214 and Cocc658 or primer pairs Cocc301, Cocc413 and Cocc658. Using ordinary PCR or nested PCR technology, two or three target gene fragments of beetle specimens are amplified, and then spliced ​​into a complete collection of beetle specimen DNA barcode sequences. The mini barcode primer designed by the invention has good amplification efficiency, overcomes the problem of low amplification efficiency of traditional barcode primers, and has extremely high amplification efficiency especially for long-lived library specimens. The primer designed by the invention can Efficiently obtain the DNA barcode sequences of beetle specimens in the collection, enrich the beetle DNA barcode database, and provide a reference for the identification of beetles using DNA barcodes.

Disclosed herein include systems, methods, compositions, and kits for in situ readout of barcodes, such as DNA barcodes. Barcode constructs containing a promoter (e.g., a phage promoter) that is inactive in live cells can be integrated in the genomes of cells. Cells can be fixed, and phage RNA polymerase can be used for transcription of the barcode to RNA transcripts. The RNA transcripts can be detected using, for example, fluorescent imaging and used to determine barcode sequences.

The invention discloses a method and a kit for amplifying the full length of a DNA barcode from a dried sargassum fly specimen stored in a library. This method provides four primers, which are LCO1490, HCO1856, HCO2198 and LCO1728 respectively; using the genomic DNA of the dried sarcophagus specimens in the library as a template, and using LCO1490 and HCO1856 as primers to perform PCR, fragment A is obtained, and HCO2198 and LCO1728 are used as primers for PCR. Fragment B was obtained by PCR; Fragment A and Fragment B were spliced ​​to obtain the full-length DNA barcode of the dried Sarmus fly specimen in the library. A kit for carrying out this method comprises primers LCO1490, HCO1856, HCO2198 and LCO1728. The method provided by the invention is accurate and fast, and compared with other direct amplified full-length amplification results, the method has good versatility for the sargassum fly, high amplification efficiency, and greater reliability and adaptability.

The invention belongs to the field of identification of species and strains, and in particular relates to a DNA barcode primer composition, a DNA barcode composition, a kit, a method and an application for identifying Arthrospora adenorivorum strains. The DNA barcode composition of the present invention comprises a first DNA barcode as shown in SEQ ID No.1, a second DNA barcode as shown in SEQ ID No.2, and a third DNA as shown in SEQ ID No.3 A barcode, wherein the first, second and third DNA barcodes are derived from the genome of the Arthrospora adenovora TMCC 70007 strain. The DNA barcode can quickly identify the Pu-erh tea fermentation strain Arthrospora adenotrophus TMCC 70007, and can quickly and accurately identify the strain from confusing strains or other strains within the same species.

The invention discloses application of a COI gene in identification of luehdorfia chinensis, and provides a plurality of analysis methods compared with a traditional DNA bar code analysis method, andthe bar code screened by the method is higher in accuracy. The invention also discloses an analysis method for evaluating the applicability of luehdorfia chinensis COI gene as a gene bar code. By means of the analysis method, two proper COI gene bar codes are provided, rapid and accurate identification of different insect states (including adults, eggs, larvae and pupae) and incomplete specimens (including partial tissues of muscles, feet, wings and body walls) is facilitated, and the identification time is shortened. The analysis method has important reference significance for screening DNA barcodes, and has a great application prospect.

The invention discloses a method for tracing pork through gene fluorescence labeling. The method comprises the following steps: step 1, extracting genome DNA (Deoxyribonucleic Acid) in tissues of pig individuals; step 2, carrying out fluorescence labeling on four types of dideoxynucleotide of the genome DNA respectively; step 3, carrying out electrophoresis on the genome DNA to mutually separate DNA molecules with different lengths; labeling the DNA molecules respectively; step 4, irradiating with ultraviolet rays, wherein the DNA molecules of the four types of labeled dideoxynucleotide emit fluorescent light of different wavelengths; DNA molecule sequences can be distinguished by analyzing light spectrums of the fluorescent light; step 5, grouping and compiling the DNA molecule sequences to form DNA barcodes corresponding to the pig individuals by combining gene types corresponding to the DNA molecules, which are generated through the electrophoresis in step 3, of the four types of dideoxynucleotide. According to the method disclosed by the invention, pork tracing detection is carried out in links including production, slaughtering, processing, sales and the like of pork; manual intervention factors are effectively avoided and the safety is ensured when people eat the pork.

The invention discloses a fragment combination, a specific primer and an application thereof for identification of Rosaceae plant species. The primer combination provided by the present invention is composed of single-stranded DNA shown in sequence 1-sequence 16 of the sequence listing. Utilizing the specific primers provided by the invention, a general kit for identifying Rosaceae plant species can be developed to promote the application of plant DNA barcodes in social services.