Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A primer pair, dna bar code for identifying relative species of E. prolifera and its application and detection method

A barcode and related species technology, applied in biochemical equipment and methods, recombinant DNA technology, DNA / RNA fragments, etc., can solve the problems of inability to distinguish species and high similarity of DNA barcode sequences, and achieve a breakthrough in over-reliance on experience Effect

Active Publication Date: 2021-08-03
INST OF OCEANOLOGY - CHINESE ACAD OF SCI
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Ulva green algae generally use DNA sequence fragments such as ITS and rbcL as DNA barcodes for species identification. However, for the related species of Enteromorpha and Enteromorpha spp., when using the commonly used molecular markers such as ITS and rbcL , the sequence similarity of the obtained DNA barcodes is very high, and they are clustered into a homologous clade in the phylogenetic analysis, and the two species cannot be effectively distinguished

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A primer pair, dna bar code for identifying relative species of E. prolifera and its application and detection method
  • A primer pair, dna bar code for identifying relative species of E. prolifera and its application and detection method
  • A primer pair, dna bar code for identifying relative species of E. prolifera and its application and detection method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] Acquisition of the DNA barcode rps7-ycf3 from the relative species of Enteromorpha

[0030] 1) Comparative analysis of chloroplast genomes of related species of Enteromorpha: .

[0031] The chloroplast genome sequences of Enteromorpha and Enteromorpha spp. were obtained from the National Center for Biotechnology Information (NCBI, http: / / www.ncbi.nlm.nih.gov / ) (Enteromorpha: KX342867.1, E. KX058323.1), using the Clustal W module in the MEGA7.0 software for genome comparison, according to the results of the chloroplast genome comparison, first find the segments with low sequence consistency between the two species, and further screen out the segments belonging to The segment of the intergenic region, and finally determined that the candidate segment is the intergenic region of rps7-ycf3 ( figure 1 ).

[0032] 2) Design of rps7-ycf3 sequence primer pair:

[0033] Using the upstream and downstream sequences of the intergenic region of rps7-ycf3 obtained above as a templ...

Embodiment 2

[0051] The Ulva sample collected from Xixiakou, Rongcheng, Shandong Province was preliminarily determined to be a type of Enteromorpha, but its species could not be confirmed. Carry out comparative identification with the inventive method:

[0052] Specific steps are as follows:

[0053] 1) Utilize conventional method to extract the DNA of the sample to be tested for use;

[0054] 2) PCR amplification:

[0055] Using the sample obtained in step 1) as a template, the primers obtained in the above examples and the Ulva ITS universal primer were used for PCR amplification respectively. The PCR conditions were: pre-denaturation at 94°C for 5 minutes; denaturation at 94°C for 30s, annealing at 55°C for 40s, and 72°C Extend at ℃ for 40s, 35 cycles; finally extend at 72℃ for 10min.

[0056] The PCR system is:

[0057]

[0058] 3) Sequencing by the above-mentioned PCR amplification product:

[0059] The nucleotide sequence of the rps7-ycf3 fragment was determined as:

[0060]...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of algae molecular markers, and in particular relates to a pair of primers for identifying DNA barcodes of Enteromorpha close relatives, a DNA barcode, and an application and detection method thereof. The primer pair for identifying the relative species of Enteromorpha, the upstream primer sequence: 5'GCTGACATACCATCACGATAGT 3'(SEQ ID U01); the downstream primer sequence: 5'CGTATTATTTTCACCAGACCTT 3'(SEQ ID U02). Application of the primer pair in identification of related species of Enteromorpha. The invention is a strong supplement to the traditional species identification, and the sample identification process can be automated and standardized, breaking through the over-reliance on experience, and can use the fragments of algae to carry out rapid and effective identification, and can establish and form in a short period of time. Easy-to-use application system.

Description

technical field [0001] The invention belongs to the technical field of algae molecular markers, and in particular relates to a pair of primers for identifying DNA barcodes of Enteromorpha close relatives, a DNA barcode, and an application and detection method thereof. Background technique [0002] Ulva prolifera, Ulva linza and Ulva flexuosa are closely related species belonging to the genus Ulva, all of which are edible green algae, but their massive proliferation will cause ecological disasters, For example, the "green tide" disaster caused by the explosive proliferation of Enteromorpha has occurred continuously in the Yellow Sea of ​​my country since 2007. Widely concerned by society, media, government and related scholars. [0003] The current identification methods for green algae of Ulva genus include morphological observation, hybridization experiment identification and DNA barcode identification, etc. Traditional morphological identification is mainly based on morpho...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/6895C12Q1/686C12N15/11
CPCC12Q1/686C12Q1/6895C12Q2565/125
Inventor 高大海孙忠民姚建亭
Owner INST OF OCEANOLOGY - CHINESE ACAD OF SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com