32 results about "Erysiphe sp." patented technology

The invention relates to an Indel mark InDel111-120 co-separated with a powdery mildew resistance allele er1-7 of peas and application thereof, and belongs to the field of plant pathology and crop disease resistance genetics and breeding. A primer for amplifying the Indel mark has the following nucleotide sequence of InDe1111-120-F:GGAGTTAAGGAACGAACTTTGG, InDel111-120-R:CCATGTCTGCGTCTGTATCTTT; a characteristic strip of the Indel mark which is amplified by the primer and co-separated with the powdery mildew resistance allele erl-7 adopts 183bp, and the nucleotide sequence is shown as Seq ID No.3. The invention further provides a kit for screening a pea genetic resource containing the er1-7 gene on the basis of the Indel mark. By adopting the Indel mark or the kit, the pea resource containing the resistance allete er1-7 can be rapidly and precisely distinguished out, so that the mark or the kit can be effectively applied to molecular assisted selection of the powdery mildew resistance of the peas, high efficiency, precision, convenience and rapidness are achieved, the breeding cycle is greatly shortened, and the breeding process is sped up.

The invention discloses a wheat anti-powdery mildew gene Pm21 linked codorminant PCR marker and its use, wherein disease-resistant gene analogues Ta-LRR2 sequence design primers NAU / XiBao 16F and NAU / XiBao 16R are obtained through suppression subtractive hybridization between Yangmai No.5 and translocation lines, a series of material tests have shown that, the label NAU / XiBao16 is interlocked with translocation lines 6VS / 6AL powdery mildew resistant gene Pm21, and one PCR experiment can amplify two specific belts from common wheat 6AS and Haynaldia Vollosa 6VS chromosomes simultaneously, the label NAU / XiBao16 can be used for the molecular label auxiliary selection in wheat powdery mildew disease resistant breeding, and for the purity identification of common wheat seeds.

The invention relates to a haynaldia villosa's 6VS chromosome specific molecular marker 6VS-BH1 and an application thereof, and belongs to the technical fields of molecular biology and genetic breeding science. The labeled primer 6VS-BH1 is developed on the basis of wheat-brachypodium distachyon comparative genomics means, and the specific sequence is 6VS-BH1F, as shown in SEQ ID NO.1, and 6VS-BH1R, as shown in SEQ ID NO.2. The molecular marker 6VS-BH1 has the advantages of wide annealing temperature range (60-66 DEG C), good stability, strong product brightness, high resolution and the like. The molecular marker 6VS-BH1, as a co-dominant marker, not only can be used for effectively tracing haynaldia villosa's 6VS chromosome in wheat background, but also can be used for distinguishing a homozygote and heterozygote and for distinguishing a Pm21 gene carried translocation line T6VS.6AL and a PmV gene carried translocation line T6VS.6DL. Therefore, the molecular marker 6VS-BH1 disclosed by the invention has an important practical value in the molecular marker-assisted selection breeding of wheat powdery mildew and the pyramiding breeding of Pm21 gene and PmV gene.

The invention discloses a method for quickly identifying a manihot esculenta mildew-resistance locus (MLO) gene, relates to knowledge of plant comparative genomics, genetics, bioinformatics and the like and belongs to the field of plant biotechnology science. The method mainly comprises the following steps of: 1) downloading a manihot esculenta whole genome sequence, and collecting the MLO gene; 2) identifying the MLO gene; 3) identifying the MLO gene according to the MLO gene phylogenetic relationship; and 4) comparing the MLO genes. By the method, the discovery cycle of the manihot esculenta MLO gene is shortened effectively, and the MLO gene can be quickly identified; corresponding coseparation functional markers (single nucleotide polymorphism (SNP) and specific combining ability (SCA)) can be developed by the identified candidate MLO gene, and the method can be quickly used for molecular marker auxiliary selection of the MLO gene, and is high in accuracy; by combining other disease-resistant gene molecular markers, multiresistance breeding materials can be prepared, the breeding cycle is shortened, and the breeding efficiency is improved; and the foundation is laid for elaborating a manihot esculenta MLO gene molecular mechanism.

The invention discloses SSR markers of powdery mildew resistance gene in wheat Fu Zhuang 30 and a method for acquiring the same, which belong to the field of crop genetic breeding science. In the research, three SSR markers linked with the powdery mildew resistance gene Pm5e in Fu Zhuang 30 are screened out, wherein two of the three SSR markers are closely linked markers and can be effectively used in the marker auxiliary selection of the powdery mildew resistance gene Pm5e in Fu Zhuang 30. With the markers as road signs, the fine positioning of the Pm5e gene or the approach to the Pm5e gene by a genome walking method can be performed. Thus, the markers lay a foundation for the clone of the Pm5e gene.

The invention relates to a method for extracting active metabolins in fermentation broth of streptomyces corchorusii NF0919 bacterial strain (whose preservation number is CGMCC (China General Microbiology Culture Center) No. 3968 and strain patent number is ZL201010236886.1). The metabolins are capable of effectively preventing and controlling Erysiphecichoracearum, Pseudoperonosporacubensis, Botrytiscinerea and Fusariumoxysporum.

The invention relates to isolation, cloning, functional verification and application of an arabidopsis powdery mildew resistance negative control gene EDR6. The invention further relates to a mutant gene of the EDR6 gene, protein coded by the EDR6 gene, application of the protein coded by the EDR6 gene, as well as application of other autophagy related protein comprising ATG5, ATG7, ATG10 and thelike and serving as powdery mildew resistance negative control factors to disease resistant process.

The invention provides a breeding method of a wheat-decaploid elytrigia elongata powdery-mildew-resisting translocation line, and further provides a T5ES-5DL translocation line yan 11-20 bred with the breeding method of the wheat-decaploid elytrigia elongata powdery-mildew-resisting translocation line and a molecular identification method of offsprings of the translocation line. The wheat-decaploid elytrigia elongate T5ES-5DL translocation line yan 11-20 bred with the breeding method is immune to current Huang-Huai wheat area erysiphe graminis, the diversity of resistant sources is achieved, the botany characteristics of the translocation line are excellent, and higher use value is achieved in wheat breeding.

The present invention discloses 3 molecular markers (6SS-1 to 6SS-3) for specifically tracking 6SS chromosomes of aegilops speotoides and a use method of the molecular markers, and relates to the technical field of molecular biology and genetic breeding science. Sequences of primers of the 6SS-1 marker are shown as SEQ ID NO.1 and SEQ ID NO.2, sequences of primers of the 6SS-2 marker are shown asSEQ ID NO.3 and SEQ ID NO.4, and sequences of primers of the 6SS-3 marker are shown as SEQ ID NO.5 and SEQ ID NO.6. The molecular markers can track the Pm12 gene from the aegilops speotoides, also cantrack a Pm21 gene from haynaldia villosa, can simultaneously distinguish and track the Pm12 gene and the Pm21 gene in a pyramiding breeding material, and have important practical value in assistant selection breeding and pyramiding breeding of the two genes.

The invention discloses a wheat powdery mildew resistance gene and an application thereof. A wheat TaJAZ1 gene from an A genome is identified from a common wheat cultivar KN199 by the inventors, overexpression of TaJAZ1 missing a jas domain is proved to be capable of leading to wheat resistance enhancement through the stable transgenic technology, and positive regulation of wheat resistance by TaJAZ1 is indicated. The invention proves for the first time that TaJAZ1 is a key regulatory gene for wheat resistance.

The invention discloses ribosome RNA gene of erysiphe alphitoides and an application thereof. The nucleotide sequence of the ribosome RNA gene of the erysiphe alphitoides is shown in SEQ ID NO.1. Thesequence can be utilized for detecting the erysiphe alphitoides and also can be applied to study on sorting of fungal species. In addition, the invention further provides a group of primers with strong specificity for detecting the erysiphe alphitoides; based on the primers, a detection method and a detection kit for detecting the erysiphe alphitoides by the specificity are established and have good application prospect in detection of the erysiphe alphitoides.

The invention belongs to the field of genetic engineering, and discloses a gene TaHBP1 with a heme-binding domain, and a recombinant interference vector and an application thereof. The gene TaHBP1 with the heme-binding domain has the cDNA sequence of SEQ ID NO.1 and a coding amino acid sequence of SEQ ID NO.2. The gene comes from ordinary triticum asetivum l. Yangmai 158. The expression of the TaHBP1 in powdery mildew-susceptible triticum asetivum l. variety Yangmai 158 is induced to enhance by erysiphe cucurbitacearum, and the expression level is much higher than the expression level in disease-resistant triticum asetivum l. variety Nannong 9918. A positive sequence of the TaHBP1 is inserted between BamHI and KpnI digestion sites of pWMB006, and at the same time, a reverse sequence is inserted between SpeI and ScI of pWMB006 to obtain interference expression vectors. The powdery mildew-susceptible triticum asetivum l. variety Yangmai 158 is transformed. The identification result of powdery mildew resistance of positive transformed plants shows that the resistance of powdery mildew-susceptible triticum asetivum l. varieties on powdery mildew is improved with decreasing expression of the TaHBP1.

The present invention relates to methods for controlling phytopathogenic fungi using biological control agents. More specifically, the invention relates to methods for controlling phytopathogenic fungi having a long incubation period. In particular, the methods according to the invention are particularly suited for controlling the causal agent of powdery mildew on grapes, the fungus Erysiphe necator.

The invention provides a rubber tree erysiphaceae avirulence gene screening method, effect protein and application. The screening method comprises the following steps: (1) selecting a coding gene A of potential effect protein from rubber tree erysiphaceae genes; (2) constructing a rubber tree erysiphaceae effect protein expression vector, and expressing and transforming a potential effect protein gene A of erysiphaceae in colletotrichum gloeosporioides to obtain a colletotrichum transformant; and (3) culturing the colletotrichum transformant with high expression degree of the effect protein, inoculating the colletotrichum transformant to an in-vitro rubber leaf, determining the pathogenic ability of the colletotrichum transformant, and if the pathogenicity of the colletotrichum gloeosporioides transformant is reduced compared with that of wild colletotrichum gloeosporioides, indicating that the effect protein coding gene A is an avirulence gene. According to the screening method disclosed by the invention, the erysiphaceae avirulence gene can be directly screened through pathogenicity of protein gene transformants with different effects, so that the avirulence gene of the erysiphaceae of the rubber tree can be more quickly screened and identified, and prevention and control of rubber erysiphaceae and breeding of disease-resistant varieties can be enhanced.

Provided herein are Vitis vinifera exhibiting Erysiphe necator resistance. In particular, provided herein are Vitis vinifera having in their genome mildew resistance locus O (MLO) genes, in particular an MLO7 gene and an MLO6 gene, where the MLO7 gene and MLO6 gene have reduced expression and / or function.

The present invention relates to powdery mildew, and especially powdery mildew caused by the plant pathogen Erysiphe heraclei, resistant carrot plants or Daucus carota plants, wherein the powdery mildew resistance is provided by one or two dominant powdery mildew resistance genes. The present invention further relates to molecular markers genetically linked to the present powdery mildew, and especially powdery mildew caused by the plant pathogen Erysiphe heraclei, resistance providing genes and the use thereof for identifying carrots plants, or Daucus carota plants, being resistant to powderymildew, and especially powdery mildew caused by the plant pathogen Erysiphe heraclei. The present invention also relates to seeds, plant parts, pollen, egg cells, callus, suspension culture, somatic embryos and edible plant parts of the present plants.

The application discloses a bacterial strain for preventing and treating preventing and treating erysiphe cichoracearum of tobacco and a fermentation method thereof, and a compounding agent for preventing and treating the erysiphe cichoracearum of the tobacco. The bacterial strain is a bacterial strain WSWFJ45; and the bacterial strain is bacillus amyloliquefaciens, and the preservation registration number of the bacterial strain is CGMCC (China General Microbiological Culture Collection Center) No.20148. The bacterial strain is applied to the agricultural production process and can effectively prevent and control the erysiphe cichoracearum of the tobacco. After a bacterial strain propagation material is compounded with a medium-low toxicity chemical pesticide, the dosage of the chemical pesticide can be effectively reduced, the dosage of the pesticide is only half of the normal dosage, and the use of the low toxicity chemical pesticide can be reduced to a great extent, so that the environmental pollution is reduced, and the safety of crops is improved; and meanwhile, through detection, the prevention and treatment effect of the compounding agent is superior to that of the chemicalpesticide merely used. The bacterial strain can effectively prevent and control the erysiphe cichoracearum of the tobacco, the application amount of the chemical pesticide can be reduced to a great extent, environmental pollution is reduced and the safety of the crops is improved.

The invention belongs to the field of gene engineering, and discloses a gene Ta (Triticum Asetivum L.) ABC1-2 having an ABC1-like kinase structural domain and application thereof. The gene TaABC1-2 having the ABC1-like kinase structural domain has a cDNA (Complementary Deoxyribonucleic Acid) sequence as shown in SEQ ID NO. 1 and an amino acid sequence coded by the gene TaABC1-2 as shown in SEQ ID NO. 2. The gene TaABC1-2 comes from triticum asetivum L. Yangmai 158. The expression of the gene TaABC1-2 in a powdery mildew-infected wheat variety-Yangmai 158 under induction of albugo candida is enhanced, and the expression level is far higher than that in a disease-resistant wheat variety-Nannong 9918. An interference expression vector is obtained by inserting a forward sequence of the gene TaABC1-2 between BamHI and KpnI restriction enzyme cutting sites of pWMB006 and simultaneously inserting a reverse sequence between SpeI and SacI of the Pwmb006, powdery mildew-infected wheat variety-Yangmai 158 is converted, and a powdery mildew-resistant identification result of a positive transformation plant shows that the resistance of the powdery mildew-infected wheat variety on powdery mildew can be increased through reduced expression of the gene TaABC1-2.

The invention discloses a fungus of the genus Diptera in plants ( Seimatosporium sp.) M7SB 41, the preservation number of which is CGMCC NO.18114 in the General Microorganism Center of the China Microbiological Culture Collection Management Committee; the strain can be applied to the prevention and treatment of tobacco powdery mildew. Erysiphe cichoracearum Tobacco powdery mildew caused by DC) has good antagonism, can significantly promote the growth of infected tobacco, and improve its disease prevention and resistance ability; the present invention has broad application prospects in the field of biological control of powdery mildew, and is a biological control agent for powdery mildew The development and application of the strain provide strain resources and theoretical basis.

The invention discloses an oak powdery mildew pathogen Erysiphe alphitoides Ribosomal RNA genes and their applications. Oak powdery mildew pathogen Erysiphe alphitoides The nucleotide sequence of the ribosomal RNA gene is shown in SEQ ID NO.1, utilizes this sequence to be able to the oak tree powdery mildew pathogen Erysiphe alphitoides For detection, the sequence can also be applied to the study of fungal species classification. In addition, the present invention also provides a group of pathogenic bacteria for detecting oak powdery mildew Erysiphe alphitoides The primers have strong specificity, and based on the primers, a specific detection method for the pathogenic bacteria of oak powdery mildew was established. Erysiphe alphitoides The detection method and detection kit, in the detection of oak powdery mildew pathogen Erysiphe alphitoides has a good application prospect.

The invention provides an amide compound and a preparation method and application thereof. The amide compound is provided with a structure shown in the formula I, has a remarkable effect on controlling diseases in agriculture and forestry and particularly has a good control effect on erysiphe cichoracearum, pseudoperonospora cubensis and phakopsora pachyrhizi; when the concentration of the amide compound is 400ppm, the control effect on the erysiphe cichoracearum is greater than or equal to 90%, and the control effect on the pseudoperonospora cubensis is greater than or equal to 90%; when theconcentration of the amide compound is 100ppm, the control effect on the phakopsora pachyrhizi is greater than or equal to 90%; and moreover, the preparation method of the amid compound is simple andefficient, large-scale production is easy, and application prospects are broad.