A gene TaABC1-2 with abc1-like kinase domain and its application
A domain and gene technology, applied in the field of genetic engineering, can solve the problems of lack of wheat powdery mildew genes, interference with powdery mildew infection, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0024] Example 1 Cloning of ABC1-like kinase domain gene TaABC1-2 expressed in Yangmai 158 induced by powdery mildew
[0025] Nannong 9918 is a new disease-resistant, high-yield, high-quality wheat variety selected from Yangmai 158 / 92R137 / / Yangmai 158 by the Institute of Cytogenetics, Nanjing Agricultural University, using modern biotechnology and conventional breeding technology (Chen Peidu, Zhang Shouzhong, Wang Xiu'e, Wang Suling, Zhou Bo, Feng Yigao, Liu Dajun. Nannong 9918, a new wheat variety resistant to powdery mildew and high yield. Journal of Nanjing Agricultural University, 2002,25(4):1438-1444). Yangmai 158 is a wheat variety cultivated by the Agricultural Science Institute in Lixiahe District, Jiangsu Province, which is susceptible to powdery mildew.
[0026] In order to screen which genes of Yangmai 158 were induced by powdery mildew in the process of susceptibility to powdery mildew, our laboratory used high-throughput sequencing to obtain powdery mildew-resista...
Embodiment 2
[0028] Example 2 Expression analysis of TaABC1-2 in resistant Nannong 9918 and susceptible Yangmai 158
[0029]In order to study the expression pattern of TaABC1-2 in materials resistant to powdery mildew, the resistant material Nannong 9918 and the susceptible material Yangmai 158 were used as templates to reverse transcribe cDNA from RNA at 0 and 24 hours induced by powdery mildew, and use P3( TCCTCTCCGATAGCTGCAAG, SEQ ID NO.5) and P4 (GTTAGGCCGGTATGCTGTTG, SEQ ID NO.6) were used as primers for real-time fluorescent quantitative PCR (Q-PCR) analysis. The PCR program is as follows: the PCR reaction is amplified on a real-time fluorescent quantitative PCR instrument (MyIQ, Bio-Rad Company, USA) and the fluorescence is detected. The 20uL PCR reaction system contains 10uL of 2×SYBR Green PCRMaster Mix, 0.5μM primers P3 and P4, and 2uL of reverse transcription cDNA template. The amplification parameters were: 95°C for 10 minutes, then 95°C for 15 seconds, 60°C for 30 seconds, an...
Embodiment 3
[0030] Example 3 Construction of TaABC1-2 interference vector pWMB006: TaABC RNAi
[0031] Interfering with TaABC1-2 gene expression pWMB006: The starting vector of TaABC RNAi is pWMB006 (TingtingChen, Jin Xiao, Jun Xu, Wentao Wan, Bi Qin, Aizhong Cao, Wei Chen, Liping Xing, ChenDu, Xiquan Gao, Shouzhong Zhang, Ruiqi Zhang, Wenbiao Shen, Haiyan Wang and XiueWang. Two members of TaRLK family confer powdery mildew resistance in commonwheat. BMC Plant Biology 2016 16:27 DOI: 10.1186 / s12870-016-0713-8). The construction process is as follows: 1. Using the cloned gene sequence of TaABC1-2 as a template, design primers P5 (TTGGATCCAGATCGACTGCACCC, SEQ ID NO.7) and P6 (TTGGTACCCACGAGTCACGACCT, SEQ ID NO.8), and P5 has the enzyme of BamHI Cutting site, P6 has a KpnI enzyme cutting site. 2. Using the plasmid containing the TaABC1-2 gene as a template, PCR amplification is performed on P5 and P6 using primers, and the amplified fragments are recovered. 3. Double digest the amplified p...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com