Patents
Literature
Hiro is an intelligent assistant for R&D personnel, combined with Patent DNA, to facilitate innovative research.
Hiro

36 results about "Microtubule-associated protein" patented technology

In cell biology, microtubule-associated proteins (MAPs) are proteins that interact with the microtubules of the cellular cytoskeleton.

EML4-ALK (Echinoderm microtubule associated protein like4-anaplastic lymphoma kinase) fusion gene fluorescent quantitative PCR (polymerase chain reaction) assay kit

The invention relates to an EML4-ALK (echinoderm microtubule associated protein like4-anaplastic lymphoma kinase) fusion gene fluorescent quantitative PCR (polymerase chain reaction) assay kit, which is applicable to assay of EML4-ALK fusion gene mutation in lung adenocarcinoma. The kit comprises probes, primers and positive controls, which are specially designed for conserved sequences of 9 fusion variations of the EML4-ALK fusion gene. The kit can be used for quickly and accurately assaying 9 most common EML4-ALK fusion gene variations with high sensitivity, namely 9 fusion variations of 7 variant subtypes, which are subtype 1 (E13; A20), subtype 2 (E20; A20), subtype 3 (E6a / b; A20), subtype 4 (E14; A20), subtype 5 (E2a / b; A20), subtype 6 (E18; A20) and subtype 7 (E14; A20), so that a real-time fluorescent quantitative PCR system for assaying 9 most common EML4-ALK fusion gene variations can be established.
Owner:广州达健生物科技有限公司

Tubulin isotype screening in cancer therapy using halichondrin B analogs

InactiveUS20060154312A1BiocideCompound screeningHalichondrin BCancer type
Chemotherapeutic agents that interfere with microtubule assembly or disassembly in the cell are potent inhibitors of cell replication. Examples of such agents include halichondrin B analogs. It has been shown that the susceptibility of certain cancers to analogs of halichondrin B correlates with the expression of particular tubulin isotypes or other microtubule-associated proteins such as MAP-4 and stathmin. Correlations such as these may be used in identifying patients suitable for treatment using a particular chemotherapeutic agent. Such a system avoids treating patients with cytotoxic compounds where there is a minimal or no effect on the cancer. The invention also provides a system of establishing these correlations for different compounds and cancer types. The system will be particularly useful in establishing correlations between anti-microtubule agents and cancers such as lung, breast, and ovarian cancer. Kits and reagents useful in practicing the invention are also provided.
Owner:EISIA R&D MANAGEMENT CO LTD

Microtubule-associated protein

InactiveUS6503708B1Avoid developmentPreventing further progressionSugar derivativesBacteriaENCODEAgonist
The invention provides a human microtubule-associated protein (HMAP) and polynucleotides which identify and encode HMAP. The invention also provides expression vectors, host cells, antibodies, agonists, and antagonists. The invention also provides methods for treating or preventing disorders associated with expression of HMAP.
Owner:INCYTE PHARMA INC

Microtubule-associated protein and coding genes and application thereof

The invention discloses a microtubule-associated protein and coding genes and application thereof. The microtubule-associated protein is protein of (a) or (b): (a) protein formed by an amino acid sequence as shown by a sequence one in a sequence table; and (b) protein derived by the sequence one, related to the inhibition of the microtubule de-polymerization activity of MCAK protein and formed ina way the amino acid sequence of the sequence one is substituted and / or deleted and / or added by one to ten amino acid residues. The protein of the invention participates in the regulation and the control of the forward end dynamics of microtubules through the mutual effect with EB1 and MCAK and stabilizes the microtubules through inhibiting the microtubule de-polymerization activity of the MCAK protein. After the coding genes of the low-interference RNA of microtubule-associated protein genes are introduced into a host, the microtubule positioning of the MCAK is seriously affected. The protein and the coding genes thereof play a great role in the medical field and the pharmaceutical field and thereby the application prospect is wide.
Owner:UNIV OF SCI & TECH OF CHINA

Tau-opathy model

InactiveUS20050009019A1Integrated precisionCompound screeningFungiPhosphorylationMicrotubule associated protein tau
The present invention relates to cell models of Alzheimer's disease. Transgenic yeast cells are described as models for the tau-opathy in Alzheimer's disease. These cell models comprise recombinant DNA constructs comprising control sequences and a cDNA sequence encoding a human tau-isoform and another similar construct comprising a protein kinase that is capable, directly or indirectly, of modulating the phosphorylation of the microtubule-associated protein tau. The transgenic cells are useful for high-throughput testing for potential therapeutic agents for Alzheimer's disease and other neurodegenerative disorders.
Owner:REMYND NV

Miniaturization cucumber plant associated protein and coding gene thereof and application thereof

The invention discloses a miniaturization cucumber plant associated protein and a coding gene thereof and an application thereof. An amino acid sequence of the protein is shown as a sequence table 2, which belongs to AAA ATP enzyme family, and is related with microtubule associated protein; the coding gene of the protein has a base sequence shown as a sequence table 1, if the mutation is generated on the base sequence, such as cytosine (C) with 1058 bp bit is substituted by thymidine (T), serine (Ser) with 353 bit for coding the protein is changed to phenylalanine (Phe), the protein inhibits the normal growth of the microtubule cell, the microtubule cytoskeleton is lost, the arrangement is abnormal, concretely, the plant phenotype is plant miniaturization, the height of the mutant plant is about 20% of the height of a normal wild type plant, the fruit length is about 10% of the length of normal wild type fruit, and the leaves and the seeds are obviously shortened. The application of the protein and the coding gene can create condition for cucumber strain-type improvement and cross breeding or exploitation of transgene plants.
Owner:NANJING AGRICULTURAL UNIVERSITY

Materials and methods for treating neurodegenerative diseases

The subject invention concerns materials and methods for treating neurodegenerative diseases and conditions associated with aggregation of the microtubule-associated protein tau. A method of the invention comprises administering an effective amount of a heat shock protein 27 (Hsp27), or a biologically-active fragment or variant thereof, or a polynucleotide encoding the same, to a person or animal in need of treatment. In one embodiment, a heat shock protein 27 (Hsp27), or a biologically-active fragment or variant thereof, is contacted with or provided to a target cell. The target cell can be a neuron. In a specific embodiment, an Hsp27 is delivered to the target cell via a polynucleotide encoding an Hsp27 protein, or a biologically-active fragment or variant thereof. In one embodiment, a method of the invention comprises injecting (e.g., via stereotaxic injection) a polynucleotide expression construct of the invention comprising a polynucleotide encoding an Hsp27 protein directly into neural tissue of a person or animal. The subject invention also concerns compositions comprising i) a heat shock protein 27, or a biologically-active fragment or variant thereof, and / or ii) a polynucleotide encoding an Hsp27, or a biologically-active fragment or variant thereof. The polynucleotide can be an expression construct that provides for expression of an Hsp27 in a target cell.
Owner:UNIV OF SOUTH FLORIDA

In vitro Screening Assay of TCPase Modulators

The present invention concerns an in vitro screening assay for identification of modulators of tubulin carboxypeptidase (TCPase) activity comprising the steps of: (i) Contacting (a) a substrate of TCPase enzyme comprising an amino acids sequence having at least the last 4 amino acids residues of the C-terminal sequence of an α-tubulin and/or a Microtubule Associated Protein (MAP) and, as ultimate C-terminal amino acid residue, an aromatic amino acid residue, preferably a tyrosine (Y), and b) an isolated or recombinant TCPase enzyme; in the presence or absence (control) of the modulator compound to be tested, and under conditions for substrate cleavage, preferably detyrosination, and/or liberation of a C-terminal free aromatic amino acid residue, preferably a C-terminal free tyrosine; (ii) Using reagents for detecting and measuring the signal related to substrate cleavage, preferably detyrosination, and/or liberation of the C-terminal free aromatic amino acid residue, preferably the C-terminal free tyrosine; (iii) Measuring and comparing the level of substrate cleavage, preferably detyrosination and/or the level of the C-terminal free aromatic amino acid residue, preferably the C-terminal free tyrosine in presence and in absence (control) of the compound to be tested, and (iv) Selecting the modulators of TCPase for which the level of substrate cleavage, preferably detyrosination or liberation of the C-terminal aromatic amino acid residue, preferably C-terminal free tyrosine is increased in the presence of the compound to be tested (activators of TCPase) or decreased in the presence of the compound to be tested (inhibitors of TCPase). The present invention also concerns kits for performing such in vitro screening assay.
Owner:CENT NAT DE LA RECHERCHE SCI +1

Means for use in treating diseases correlated with or caused by non-physiological levels of microtubule-associated PP2Ac

The present invention relates to a method of preventing or treating a disease correlated with or caused by non-physiologically increased intracellular levels of the catalytic subunit of microtubule-associated protein phosphatase 2A (PP2Ac) comprising administering to a subject affected by said disease or in danger of developing said disease a pharmaceutically effective amount of a protein selected from the group of MID1 or MID2 or a nucleic acid encoding said protein. The invention further relates to a method of preventing or treating a disease correlated with or caused by non-physiologically decreased intracellular levels of the catalytic subunit of microtubule-associated protein phosphatase 2A (PP2Ac) comprising administering to a subject affected by said disease or in danger of developing said disease a pharmaceutically effective amount of a peptidic fragment of MID1 or MID2 wherein said peptidic fragment comprises amino acids 108-165 (preferably 110-165) of MID1, amino acids 108-165 (preferably 110-165) of MID2 or with an effective amount of a fragment of PP2Ac wherein said fragment comprises the binding site to a4 or of a peptide fragment of a4 comprising amino acids 236-279 or with an effective amount of a nucleic acid molecule encoding said peptide fragment or with an effective amount of a molecule interfering with the interaction of MID1 with a4 or with an effective amount of a molecule interfering with the expression or activity of MID1 and / or a 4.
Owner:MAX PLANCK GESELLSCHAFT ZUR FOERDERUNG DER WISSENSCHAFTEN EV

Means for use in treating diseases correlated with or caused by non-physiological levels of microtubule-associated pp2ac

The present invention relates to a method of preventing or treating a disease correlated with or caused by non-physiologically increased intracellular levels of the catalytic subunit of microtubule-associated protein phosphatase 2A (PP2Ac) comprising administering to a subject affected by said disease or in danger of developing said disease a pharmaceutically effective amount of a protein selected from the group of MID1 or MID2 or a nucleic acid encoding said protein. The invention further relates to a method of preventing or treating a disease correlated with or caused by non-physiologically decreased intracellular levels of the catalytic subunit of microtubule-associated protein phosphatase 2A (PP2Ac) comprising administering to a subject affected by said disease or in danger of developing said disease a pharmaceutically effective amount of a peptidic fragment of MID1 or MID2 wherein said peptidic fragment comprises amino acids 108-165 (preferably 110-165) of MID1, amino acids 108-165 (preferably 110-165) of MID2 or with an effective amount of a fragment of PP2Ac wherein said fragment comprises the binding site to a4 or of a peptide fragment of a4 comprising amino acids 236-279 or with an effective amount of a nucleic acid molecule encoding said peptide fragment or with an effective amount of a molecule interfering with the interaction of MID1 with a4 or with an effective amount of a molecule interfering with the expression or activity of MID1 and/or a 4.
Owner:MAX PLANCK GESELLSCHAFT ZUR FOERDERUNG DER WISSENSCHAFTEN EV

Method for detecting expression level of MAP7 in CN-AML tissue sample and application thereof

The invention discloses a method for detecting the expression level of MAP7 in a CN-AML tissue sample and an application thereof. The invention provides primer pairs of a microtubule-associated protein 7 gene, wherein the sequences of one primer pair are tcctgggagctgcaattaca (SEQ ID NO:2) and gggtgcttttggtcttctgg (SEQ ID NO:3) or complementary sequences thereof. In the invention, the primer pairs are used for performing risk stratification or clinical prognosis evaluation for patients suffering normal karyotype acute myelogenous leukemia by detecting the expression level of microtubule-associated protein 7. The invention also provides a gene chip and a kit comprising the primer pairs.
Owner:PEKING UNIV THIRD HOSPITAL
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products