Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Bacillus coagulans BC66 and application thereof

A technology of Bacillus coagulans and BC66, which is applied in the field of microorganisms, can solve the problems of reduced safety of livestock or aquatic products, increased disease rate and mortality, and impact on animal growth performance, so as to improve the body's immunity and enhance intestinal function , the effect of strong ability to inhibit pathogenic bacteria

Pending Publication Date: 2021-11-30
JIANGSU WECARE BIOTECHNOLOGY CO LTD
View PDF1 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0002] At present, due to excessive use of antibiotics, chemical drugs, and hormones in the process of animal husbandry or aquaculture in my country, drug residues and pollution problems have resulted in reduced safety of animal husbandry or aquatic products in the long run, affecting human health
At the same time, in terms of breeding costs, such as the impact of decreased animal resistance, intestinal dysfunction, and frequent diseases, the growth performance of animals is affected, the disease rate and mortality rate increase, and the cost is relatively high.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Bacillus coagulans BC66 and application thereof
  • Bacillus coagulans BC66 and application thereof
  • Bacillus coagulans BC66 and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] The screening of embodiment 1 bacillus coagulans BC66

[0029] Weikang Probiotics (Suzhou) Co., Ltd. has preserved more than 20,000 probiotic strains from different genera and species isolated from nature, among which 50 strains are Bacillus coagulans derived from the intestinal contents of healthy piglets. We obtained these Among the strains, a strain BC66 with particularly strong acid production ability was screened.

Embodiment 2

[0030] Embodiment 2 Bacillus coagulans BC66 physicochemical properties

[0031] Bacillus coagulans BC66, Gram-positive rod-shaped bacteria, catalase-positive, oxidase-negative, can form spores, and spores are terminal. The results of growth experiments showed that the strain could utilize α-D-glucose, D-mannose, gentian ditang, α-D-lactose, D-fructose, D-melibiose, D-trehalose, D-galactose, D-cellulose, D-fucose, L-fucose, L-rhamnose, D-maltose, Songertang, D-fructose-6-phosphate, glycine-L-proline, D- Galacturonic acid, D-gluconic acid, L-malic acid, L-galactonolactone, methyl pyruvate, D-gluconic acid aldehyde, D-mannitol, D-arabinitol, β-methyl -D-glucoside, N-acetyl-D-glucosamine, glucuronamide, N-acetyl-β-D-mannosamine, dextrin, glycerin, L-lactic acid. The results of chemical sensitivity experiments showed that the strain was resistant to troleandomycin, rifamycin SV, minocycline, vancomycin, sodium tetradecyl sulfate, tetrazolium blue, fusidic acid, lincomycin, Guani...

Embodiment 3

[0032] The 16S rRNA gene sequence determination result of embodiment 3 Bacillus coagulans BC66

[0033] Liquid expansion culture, collecting bacteria, extracting genomic DNA, using universal primers 27F: AGAGTTTGATCCTGGCTCAG (SEQ ID No 2) and 1492R: GGTTACCTTGTTACGACTT (SEQ ID No 3) to amplify its 16S rDNA fragment, and using agarose gel electrophoresis to detect PCR amplification. increase product. The obtained target fragments were sequenced and analyzed, and the sequencing results were compared and analyzed in the NCBI database. The obtained strain was identified as Bacillus coagulans, and its classification was named Bacillus coagulans. General Microbiology Center (CGMCC) of Species Collection Management Committee, address: No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, the preservation number is CGMCC21879, and the strain number is BC66.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of microorganisms, and relates to bacillus coagulans BC66 and application thereof. The bacillus coagulans BC66 strain in the invention is separated from intestinal tracts of piglets, is high in acid production speed, has relatively high pathogenic bacterium inhibition capability and is high in disease resistance. The spore number is high; and the spore number of bacterial powder prepared through scale-up culture of a 100L fermentation tank can reach 2.5*10<11> CFU / g. Bacterial powder prepared from the strain can tolerate acid, alkali and bile and can smoothly enter large intestines through the gastrointestinal tract environment,; the cell survival rate of the bacillus coagulans BC66 reaches up to 88.5%; and the bacillus coagulans BC66 can effectively play a probiotic role in organisms. The invention provides the application of the bacillus coagulans BC66 or the bacterial powder of the bacillus coagulans BC66 as an additive of a feed or a medicine in livestock breeding.

Description

technical field [0001] The invention belongs to the technical field of microorganisms, and in particular relates to a probiotic bacillus coagulans BC66 and an application thereof. Background technique [0002] At present, the excessive use of antibiotics, chemical drugs, and hormones in the process of animal husbandry or aquaculture in my country has led to drug residues and pollution problems. In the long run, the safety of animal husbandry or aquatic products has been reduced, affecting human health. At the same time, in terms of breeding costs, such as the impact of decreased animal resistance, intestinal dysfunction, and frequent diseases, the growth performance of animals is affected, the disease rate and mortality rate increase, and the cost is relatively high. [0003] Bacillus coagulans is a Gram-positive bacterium that not only produces lactic acid but also produces spores. In addition to all the characteristics of lactic acid bacteria, Bacillus coagulans also has ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N1/20A23K10/18A61K35/742A61P31/04C12R1/07
CPCC12N1/20A23K10/18A61K35/742A61P31/04
Inventor 方曙光朱明明孔素芬项丽娟
Owner JIANGSU WECARE BIOTECHNOLOGY CO LTD
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More