Recombinant aviadenovirus type 4 fiber2 protein as well as preparation method and application thereof
A poultry adenovirus and recombinant protein technology, applied in the field of genetic engineering, can solve the problems of uncontrollable product quality, poor immune effect, and poor immunogenicity, and achieve the effects of controllable quality, improved solubility, and improved immunogenicity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0025] Embodiment 1 Preparation of recombinant adenovirus type 4 fiber2 protein
[0026] 1. Cloning and sequencing of FAdV-4fiber2 protein coding gene
[0027] Extract total DNA from chicken liver tissue infected with FAdV serotype 4, use Fiber 2PF / Fiber 2PR primers (SEQ ID NO.17-18), and use total DNA as a template to amplify the fiber2 gene by PCR. The length of the gene is 1440bp .
[0028] The primer sequences used to amplify the fiber2 gene are as follows:
[0029] Fiber 2PF: GAGCTC ATGCTCCGGGCCCCTAAAAGAAGAC
[0030] Fiber 2PR: AAGCTT TTACGGGAGGGAGGCCGCTGGACAGCT
[0031] (The underlined part in Fiber 2PF is the cutting site of SacI restriction endonuclease, and the underlined part in Fiber 2PR is the cutting site of HindⅢ restriction endonuclease)
[0032] The amplification system (20μL) is:
[0033]
[0034] After the PCR, the target gene fragment was recovered by agarose gel electrophoresis, and then TA cloning was performed, and the TA cloning system was sp...
Embodiment 2
[0073] Example 2 E.coli BL21(DE3) / pET28a FAdV Nd274 fiber2 M3 expression protein detection analysis and purification
[0074] 1. Detection and analysis of expressed protein
[0075] The expression engineered strain E.coli BL21(DE3) / pET28a FAdV Nd274 fiber2 M3 was induced to express. The inducer is α-lactose, and the working concentration is: 0.03mol / L. After ultrasonic centrifugation, the expression level and dissolution status of the target protein in the bacteriostasis solution before and after centrifugation were detected by SDS-PAGE electrophoresis.
[0076] The results of SDS-PAGE electrophoresis detection of the engineered bacteria E.coli BL21(DE3) / pET28a FAdV Nd274 fiber2 M3 are shown in the attached figure 2 Shown, where lane 1 is the blank control E.coli BL21(DE3) / pET28a without the target fragment, and lane 2 is Marker (14, 25, 30, 40, 50, 70, 100, 120kDa respectively from small to large ), lane 3 is the whole bacterial solution of FAdV Nd274 fiber2 M3 expressing...
Embodiment 3
[0085] Example 3 Preparation of FAdV-4 Genetic Engineering Subunit Vaccine and Immune Challenge Experiment
[0086] 1. Vaccine preparation
[0087] After the FAdV 4Nd274 fiber2 M3 purified protein obtained in Example 2 was treated with endotoxin, it was diluted with PBS solution to contain the target protein at 100 μg / ml. According to the ratio of protein solution:vaccine adjuvant=1:3 (W / W), the vaccine adjuvant MONTANIDEIM ISA 71VG was added to prepare the finished vaccine for subsequent immune challenge experiments, wherein the target protein content was 25 μg / ml.
[0088] 2. Grouping and immunization of experimental chickens
[0089] Choose 2 weeks old SPF chicken, be divided into 6 groups altogether, every group 8, the processing mode of every group is as follows:
[0090] 1. Experimental group 1: 0.1 mL of the above-mentioned finished vaccine was immunized once (2.5 micrograms of protein per animal), and the virus was challenged 28 days after immunization;
[0091] 2. ...
PUM
Property | Measurement | Unit |
---|---|---|
diameter | aaaaa | aaaaa |
molecular weight | aaaaa | aaaaa |
molecular weight | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com