Method for producing antiangiogenesis agent RT-X in colibacillus and application of antiangiogenesis agent RT-X
A technology of RT-X and Escherichia coli, applied in the field of fusion protein RT-X technology and separation and purification, can solve problems such as RGD without literature reports
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0083] Example 1 Cloning, expression, separation and purification of the vascular inhibitor RT-X gene
[0084] The Maspin gene refers to the cDNA sequence of Maspin (Genbank sequence number: AY893387.1), and the gene sequence is shown in SEQ ID NO:5;
[0085] ATGGATGCCCTGCAACTAGCAAATTCGGCTTTTGCCGTTGATCTGTTCAAACAACTATGTGAAAAGGAGCCACTGGGCAATGTCCTCTTCTCTCCAATCTGTCTCTCCACCTCTCTGTCACTTGCTCAAGTGGGTGCTAAAGGTGACACTGCAAATGAAATTGGACAGGTTCTTCATTTTGAAAATGTCAAAGATGTACCCTTTGGATTTCAAACAGTAACATCGGATGTAAACAAACTTAGTTCCTTTTACTCACTGAAACTAATCAAGCGGCTCTACGTAGACAAATCTCTGAATCTTTCTACAGAGTTCATCAGCTCTACGAAGAGACCCTATGCAAAGGAATTGGAAACTGTTGACTTCAAAGATAAATTGGAAGAAACGAAAGGTCAGATCAACAACTCAATTAAGGATCTCACAGATGGCCACTTTGAGAACATTTTAGCTGACAACAGTGTGAACGACCAGACCAAAATCCTTGTGGTTAATGCTGCCTACTTTGTTGGCAAGTGGATGAAGAAATTTCCTGAATCAGAAACAAAAGAATGTCCTTTCAGAGTCAACAAGACAGACACCAAACCAGTGCAGATGATGAACATGGAGGCCACGTTCTGTATGGGAAACATTGACAGTATCAATTGTAAGATCATAGAGCTTCCTTTTCAAAATAAGCATCTCAGCATGTTCATCCTACTACCCAAGGATGTGGAGGATGAGTCCACAGGCTTGGAGA...
Embodiment 2
[0105] Example 2 Analysis of biological activity of fusion protein RT-X
[0106] 1. Endothelial Cell Migration Assay
[0107] Matrigel preparation: place the matrigel frozen at -80°C at 4°C overnight to become liquid; take 150 μL of Matrigel, coat the upper chamber of the Transwell (operated on ice), put it in a 37°C incubator, and incubate for 1 hour; digest HUVEC cells were washed 3 times in serum-free medium, counted, and made into 2×10 6 Cell suspension; wash Matrigel-coated Transwell once with serum-free medium; add 100 μL cell suspension to each well; add 600 μL conditioned medium containing 20% FBS to the lower chamber of Transwell; incubate at 37°C for 48 hours; take out Wash 2 times with PBS, wipe off the upper surface cells with cotton balls, fix with neutral formaldehyde for 10 minutes; add crystal violet (0.1%) to stain for 10 minutes, wash 2 times with PBS at room temperature, observe and take pictures under a microscope. Count the number of positively stained...
PUM
Property | Measurement | Unit |
---|---|---|
Average volume | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com