Lactobacillus salivarius MG-587 and application thereof
A technology of Lactobacillus salivarius and bacterial liquid, applied in the field of microorganisms, can solve problems such as disorder, abnormal increase in blood sugar level, tissue and organ lesions, etc., and achieve the effect of reducing fat cells, reducing visceral fat weight, and improving liver function.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0024] Isolation, identification and performance measurement of embodiment 1 bacterial strain
[0025] 1. 16S rDNA identification
[0026] Take 5g of feces samples from healthy people, add them into 50mL of sterile water, oscillate and mix, and then serially dilute, spread on MRS+bromocresol purple and MRS+mupirocin lithium salt selective medium plates respectively, place at 37 ℃, anaerobic overnight culture, pick a single colony for purification, and then carry out 16S rDNA strain identification.
[0027] 16S rDNA identification: Genomic DNA extraction, using universal primers:
[0028] 27F: AGAGTTTGATCCTGGCTCAG;
[0029] 1492R: TACGGCTACCTTGTTACGACTT
[0030] The PCR amplification of the 16S rDNA fragment was carried out, and the amplified fragment was submitted to Qingke Biological Company for sequencing. The sequencing result is shown in the sequence table SEQ ID NO:1. After comparison, a strain of Lactobacillus salivarius was obtained, which was named Lactobacillus sa...
Embodiment 2
[0077] Example 2 Lipid-lowering efficacy of Lactobacillus salivarius MG-587
[0078] 1. Fat cell experiment
[0079] Cell differentiation induction: when the cell confluency is 70-80%, follow the CL-173 TM Harvest cells by trypsinization according to the subculture-related instructions provided in the product insert. Cells were seeded in preadipocyte expansion medium (90% DMEM, 10% calf serum) and grown for 48 hours, or until the culture reached 100% confluency. After an additional 48 hours of incubation, the preadipocyte expansion medium was removed from each well, and the same volume of differentiation medium (90% DMEM, 10% fetal bovine serum FBS, 1.0 μM dexamethasone, 0.5 mM methyl isobutylxanthine (IBMX), 10 μg / mL insulin). At the same time, according to the ratio of 1:1000, add inactivated bacteria solution.
[0080] Incubate in differentiation medium for 48 hours, replace the differentiation medium with adipocyte maintenance medium (90% DMEM, 10% fetal bovine serum...
Embodiment 3
[0094] Example 3 Animal experiment of Lactobacillus salivarius MG-587
[0095] 1. Materials
[0096] Bacterial suspension preparation: After the strain was activated and transferred twice, it was cultivated to the stationary phase under suitable culture conditions, 6000rpm / min, centrifuged for 10min to collect the bacterial cells, washed and resuspended with PBS.
[0097] Groups: conventional feed control group, high-fat feed control group (Changzhou Shuyishuer Biotechnology Co., Ltd.), probiotics treatment group, 5 mice in each group.
[0098] 2. Establishment of hyperlipidemia mouse model
[0099] 1) Experimental animals: 8-week-old male C57BL / 6J mice (SPF grade), fed in an environment with a constant temperature of 25±2°C, a relative humidity of 50±5, and a day-night cycle of 12 / 12h.
[0100] 2) After a week of normal diet (ND) adaptation, they were randomly divided into two groups according to body weight. One group was given normal maintenance diet as a blank control, a...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com