36results about How to "Shorten the number of years" patented technology

The invention relates to a substrate culture method for reducing continuous cropping obstacle of rehmannia, which comprises steps including 1sterilizing soil with 0.5% ethanol before planting; 2 adopting mixture of turf, vermiculite and pearlite as the substrate, spraying water containing fungicide before using, enabling water content of the substrate to reach 60%, maintaining for one week; 3 removing bottoms of nutrient earthen bowls or bottoms of nutrient bags, adding treated substrate into the nutrient earthen bowls or the nutrient bags, then placing and planting rehmannia into the nutrient earthen bowls or the nutrient bags, sowing the rehmannia on treated rectangular pieces of land in a field according to 25cm line spacing, 20cm row spacing, the holes are 8-10cm in depth, placing thenutrient earthen bowls or the nutrient bags planted with the rehmannia into the land, watering sufficiently, covering coil for about 0.5-1cm to facilitate moisturizing; and 4 performing field management according to normal planting during growth period. The substrate culture method for reducing continuous cropping obstacle of rehmannia effectively resolves the continuous planting obstacle problems that after one year of rehmannia planting, when the rehmannia is replanted, disease is serious, plants die in mass, yield is reduced sharply, and the rehmannia must be planted on other fields.

The invention relates to a method for rapidly obtaining a pure line of hybrid wheat, comprising the following steps: (1) preparing a hybridized combination; (2) planting a hybrid material; (3) determining an appropriate ear fetching period; (4) pre-treating anther; (5) dissociating and purifying microspores: (6) adjusting the density of the microspores; (7) forming microspore embryos by induction; (8) forming regenerated plants by differentiation culture; (9) allowing regenerated seedlings to pass the summer at low temperature; (10) culturing the strong seedlings; (11) hardening the seedlings; (12) transplanting the seedlings; (13) managing the transplanted seedlings; and (14) harvesting after the seedlings become mature. In the method, a test material is directly planted in a field and the microspores are dissociated from the anther for culture to eliminate the disturbance of an anther wall, thus being beneficial to optimization of various culture factors, improving the induction frequency of the microspore embryos, overcoming limitation on a genotype, promoting more hybrid combined materials to obtain the regenerated plants, providing more abundant base materials for variety breeding, and playing an important role in enhancing the breeding efficiency of a haploid.

The invention discloses a molecular marker BSA10 for early identification of melon sm5 type male sterile and application of molecular marker BSA10. The primer sequence of the molecular marker BSA10 is: BSA10F: AGTAGCAACTCTCGTGGCCTATTAG; and BSA10R: GCAAGACTCAAGATCAAGTGGCATAT. The above molecular marker BSA10R can be used for identifying the melon male sterile ms5 gene and melon molecular marker assistant breeding. According to the high throughput sequencing, the melon genome data can be obtained, and caps molecular mark related to the melon male sterile can be designed and developed. The molecular marker-assisted selection method can screen the melon male sterile plant on the seedling stage of melon, shorten the breeding period, improve the breeding efficiency, overcome the problem of low breeding efficiency due to the fact that melon male sterile plant can be distinguished only in the flowering period in the prior art and realize the technical effect that melon male sterile identification can be conducted on the seedling stage.

The invention relates to a method for massively planting apocynum venetum on saline-alkali desert lands. The method is implemented by the steps of seed screening, nutrition cup preparation, room-temperature facility arrangement, seeding in time, seeding amount control, management during seedling time, nursery garden transplanting, nursery garden field management and large-field transplanting. In the method, massive and productive apocynum venetum planting experiments are carried out under specific weather conditions in the Altay region of Xinjiang, and the experiments prove that when the method is used, the survival rate of the apocynum venetum large-field strains planted on the gobi desert lands reaches 95.8 to 96.4 percent, a service life is shortened, and an application prospect is wide. Particularly, the seedling plants for the gobi desert lands can be cultivated in one year, so that the shortcoming that the conventional large field or nursery garden seedlings raised by direct seeding are transplanted to the gobi desert lands after 2 to 3 years generally is overcome and the massive planting and mechanical field management are realized.

The invention discloses a molecular marker BSA3-2 closely linked with a muskmelon male sterility ms5 gene and application of the molecular marker BSA3-2. Primer sequences of the molecular marker BSA3-2 are BSA3-2F:TGCTTATGTGAGTGAGTCTGCTGAC, and BSA3-2R:CAATGGTGTGGTGGAAGTTCTGGAA. The molecular marker BSA3-2 can be used for identification of the muskmelon male sterility ms5 gene and molecular marker-assisted breeding of muskmelons. According to the molecular marker BSA3-2 and the application thereof disclosed by the invention, a genome data of the muskmelons are obtained according to a high throughput sequencing technology; a caps molecular marker related to muskmelon male sterility is designed and developed; by using the method of molecular marker-assisted selection breeding, the screening of muskmelon male sterility plants can be performed at a seedling stage of the muskmelons, so that the age limit of breeding is shortened, the breeding efficiency is improved, and the problem of low breeding efficiency due to the fact that the muskmelon male sterility plants can be only distinguished at a flowering stage in the prior art is solved.

The invention discloses a method for breeding transgenic cotton bollworm-resistant cotton hybrids, which is specially used for the breeding of cotton bollworm-resistant cotton hybrids transgenic with Bt+CpTI bivalent genes. The insect resistance identification and breeding of the transgenic insect-resistant cotton "SGK321" were carried out, and the insect-resistant homozygous (100%) transgenic insect-resistant cotton "SGK321'" with lint yield increased by 9.5% compared with the raw material was obtained. The insect-resistant hybrid "Nankang 7" was bred with "SGK321'" as the male parent and "Sumian 12" as the female parent. The hybrid has high yield (90-150 kg of lint per mu), high resistance to cotton bollworm and can restrain possible resistance of cotton bollworm to cotton.

The invention discloses an early screening method for good varieties of bundle plant type nobile-type dendrobium. The method comprises the following steps: a, determining the number of leaves and the number of segments of one-year-old seedlings in a leaf termination period; b, respectively substituting the mean values of the number of leaves and the number of segments into corresponding linear equations y1=2.061x1(the number of leaves)-8.060, and y2=1.534x2 (the number of segments)-7.654; calculating the comprehensive score of the quality of nobile-type dendrobium flowering; c, predicting the nobile-type dendrobium flowering quality according to the comprehensive score of the quality of nobile-type dendrobium products and a variety grade dividing reference standard. According to the early screening method for good varieties of the bundle plant type nobile-type dendrobium disclosed by the invention, the variety screening efficiency is improved; the screening cycle is shortened; the production cost is reduced.

The invention relates to a cultivation method for intercropping alfalfa and wheat under an apricot and plum forest in an oasis-desert transition zone. Cultivation methods include: soil preparation, apricot and plum gardening, alfalfa and wheat sowing field water and fertilizer management, alfalfa and wheat harvesting, alfalfa pest control. The cultivation method can prevent wind and fix sand, improve soil nutrition, and increase soil water retention capacity, thereby improving the planting environment, increasing the emergence rate of direct-seeded peaches, and the grafting survival rate of apricots and plums in the later stage, and can shorten the period of fruit-bearing of apricots and plums to see benefits by 2 In addition, it can also improve the utilization rate of cultivated land. While harvesting apricots and plums in one year, you can also harvest three seasons of alfalfa, and the yield is about 15% higher than that of growing alfalfa alone. Provide a large amount of forage for cattle and sheep in the area to reduce the ecological pressure on the grassland. The economic benefit and ecological benefit are remarkable, and it has broad application prospects.

The invention discloses a cultivating method of an arbor-type malvaviscus arboreus landscape tree. The method comprises the steps that hibiscus tiliaceus or H.tilliaceus 'tricolor' serves as a rootstock for grafting, a semi-lignified branch of malvaviscus arboreus is cut short and serves as a scion; in the grafting process, a split opening of the rootstock is made to be aligned with one side of wedged edges of the scion, the upper portion of the wedged part of the scion is reserved by 0.1-0.3 cm to be exposed outside, and the scion is bundled tightly through thin film; after grafting is completed, rootstock bud removing, thin film needling, scion pruning and positive management are conducted in time. According to the cultivating method of the arbor-type malvaviscus arboreus landscape tree, the advantages of the malvaviscus arboreus and hibiscus tiliaceus tree species are integrated into a whole, and the ornamental value, landscape value and economic value of the malvaviscus arboreus are significantly improved; the time for cultivating arbor-type malvaviscus arboreus is shortened, and the defect that the malvaviscus arboreus is poor in dryness is overcome.

The invention belongs to the technical field of plant cultivation, and in particular relates to a method for rapidly obtaining old seedlings of primula moss. In this method, water control is carried out in a specific way after the primula seedlings are slowed down and potted. The method in the invention can shorten the age of the old pile seedlings, enrich the appearance of the old pile seedlings, solve the problem of long period, and provide bonsai materials with various shapes.