Preparation method of animal model with high expression of genes transfected through endotracheal pathway in lung tissues
An animal model, lung tissue technology, applied in the fields of botanical equipment and methods, biochemical equipment and methods, and devices for restraining animals, etc., can solve problems such as difficulty in controlling drug doses, reducing the success rate of puncture, and limiting experimental progress. Achieve the effect of improving transfection targeting, good practicability, and speeding up the experimental process
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0037] Example 1 Constructing a recombinant adenovirus vector carrying VEGF-A
[0038]1. Construction of VEGF-A overexpression adenovirus vector: the name of the vector is GV314 (element sequence: CMV-MCS-3FLAG-SV40-EGFP), the vector is linearized by digestion with BamHI / AgeI, and the human source of the target gene is amplified by PCR For VEGF-A, the PCR reaction system is shown in Table 1, and the amplification product is shown in figure 1 , the specific sequence of the amplification primer is as follows:
[0039] VEGFA(4907-1)-P1: AGGTCGACTCTAGAGGATCCCGCCACCATGAACTTTCTGCTGTCTTGG; (SEQ ID NO. 1)
[0040] VEGFA(4907-1)-P2: TCCTTGTAGTCCATACCCCGCCTCGGCTTGTCAC (SEQ ID NO. 2).
[0041] Table 1 reaction system
[0042] Reagent Volume (μL) wxya 2 o
32.5 5×PS Buffer 10 dNTP Mix (2.5mM each) 4 Upstream amplification primer (10μM) 1 Downstream amplification primer (10μM) 1 template 1 (10ng / μL)
1 PrimeSTAR HS DNA polymera...
Embodiment 2
[0047] Embodiment 2 self-made endotracheal tube
[0048] Take a 4.5F scalp needle, remove the extension tube, connect the front end of the needle core to the PE50 catheter, about 1.5-2.0 cm beyond the needle core; cut off the front end of the 1.9F central venous catheter core, and insert it into the scalp needle (the insertion depth is shorter than the front end of the PE50 catheter), On the one hand, the length of the tracheal tube is extended for easy operation; on the other hand, the hardness of the front end of the PE50 tube is increased to facilitate insertion into the trachea of newborn rats. After the completion of the self-made tracheal tube, soak it in 75% alcohol for later use. figure 2 .
Embodiment 3
[0049] Embodiment 3 constructs rat model
[0050] 1. Set the parameters of the small animal ventilator: respiratory rate 90-100 times / min, tidal volume 4-6ml / kg, spare.
[0051] 2. Take 20-30 g of newborn rats for modeling, anesthetize them intraperitoneally with ketamine (100 mg / kg) and xylazine (10 mg / kg), and perform tracheal intubation after the anesthesia takes effect.
[0052] 3. Hang the front incisors of the newborn rats, and stick the back to the tripod to fix the newborn rats. The LED light faces the head and face of the newborn rats to irradiate the neck. Use a tracheal tube to measure the distance from the front incisors to the body surface of the larynx, and mark it .
[0053] 4. The operator faces the back of the newborn rat, and pulls out the tongue from the left corner of the rat’s left mouth with the left hand. A light spot about 2 mm in size can be seen in the middle of the throat, which can open and close with the breathing movement, which is the glottis T...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap