Porcine epidemic diarrhea virus and culture method and application thereof
A porcine epidemic diarrhea and virus technology, applied in the direction of viruses, antiviral agents, virus antigen components, etc., can solve the problems of poor treatment effect and difficult prevention, and achieve the effect of good immunogenicity and strong pathogenicity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
specific Embodiment approach 1
[0026] Embodiment 1: Isolation and cultivation of virus
[0027] The small intestine of piglets with diarrhea was sent to a pig farm in Ningbo City, Zhejiang Province. The intestinal wall and contents were collected and tested by RT-PCR. The result was positive for porcine epidemic diarrhea antigen, and porcine epidemic diarrhea virus PEDV / CH / NB was obtained / 2014 ( figure 1 ).
[0028] Take an appropriate amount of the small intestine submitted for inspection, scrape the intestinal mucosa and contents, add physiological saline according to the ratio of 1:5 (weight: volume), grind, freeze and thaw repeatedly 3 times, centrifuge at 8000r / min for 10min, take the supernatant, 0.22μm Membrane filtration, the resulting treatment solution for disease material was subpackaged and stored in a -80°C refrigerator for later use.
[0029] Cultivate Vero cells with cell culture medium to form a cell monolayer, discard the growth medium of the monolayer of Vero cells, wash the cells 3 tim...
specific Embodiment approach 2
[0031] Specific embodiment 2: RT-PCR detection of cell culture
[0032] PEDV / CH / NB / 2014 5th, 10th, 15th, 20th, and 25th passage cell cultures were taken 250 μL respectively, and RNA was extracted using the Total RNA Kit II kit produced by OMEGA Company. The extracted RNA was reverse-transcribed: 6 μL of RNA was mixed with 1 μL Oligo(dT), heated at 70°C for 10 min, and quickly placed in an ice bath for 2 min. Add 2 μL 5×Buffer, 0.5 μL 10 mM dNTP mix, 0.25 μL MLV reverse transcriptase and 0.25 μL RNase Inhibitor to the mixture. After mixing, react according to the following conditions: 42°C, 60 min; 70°C, 15 min.
[0033] The reverse-transcribed cDNA was subjected to PCR with the following primers to amplify the N gene, upstream primer NF: 5'CGGTTCTCACAGATAGTGAG 3', SEQ ID NO: 17; downstream primer NR: 5'CGCTAGAAAAACACTCAGTAAT 3', SEQ ID NO: 18. The reaction system is: cDNA 1 μL, 2×Taq Mix 12.5 μL, 10 μM / mL upstream and downstream primers 0.5 μL each, add deionized water to 25...
specific Embodiment approach 3
[0035] Specific embodiment 3: detection of virus titer
[0036] The virus titer of PEDV / CH / NB / 2014 was determined by microtitration method, and the method was as follows: Vero cells were used to measure the virus titer. Use a 96-well cell culture plate to cultivate Vero cells, dilute the virus from 10-1 to 10-10 with DMEM without serum, and inoculate 100 μL of each dilution of the virus solution into the culture wells covered with Vero cells, Inoculate 8 wells for each dilution, and set negative cell control wells at the same time. Place it in a 37°C, 5% CO2 incubator, observe the virus infection of the cells in 4-6 days, and calculate the virus titer. The highest virus price can reach 108.5TCID50 / ml.
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com