Eureka AIR delivers breakthrough ideas for toughest innovation challenges, trusted by R&D personnel around the world.

Application of human sDR5-Fc recombinant fusion protein in preparation of medicine for preventing and treating myocardial infarction and ischemia reperfusion injury

A technology of ischemia-reperfusion and fusion protein, which is applied in the direction of animal/human protein, fusion polypeptide, drug combination, etc., can solve the problem of transmitting apoptosis signal, reduce cell apoptosis rate, increase survival rate, and reduce infarct size Effect

Pending Publication Date: 2021-02-02
SHENZHEN ZHONGKE AMSHENN MEDICINE CO LTD
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

sDR5 retains the activity of binding to TRAIL ligands, but cannot transmit apoptosis signals to cells, and can block the TRAIL-DR5-mediated apoptosis response

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of human sDR5-Fc recombinant fusion protein in preparation of medicine for preventing and treating myocardial infarction and ischemia reperfusion injury
  • Application of human sDR5-Fc recombinant fusion protein in preparation of medicine for preventing and treating myocardial infarction and ischemia reperfusion injury
  • Application of human sDR5-Fc recombinant fusion protein in preparation of medicine for preventing and treating myocardial infarction and ischemia reperfusion injury

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0064] Example 1 Design and Recombination of Recombinant Human DR5-Fc Expression Sequence

[0065] After long-term accumulation of experience, the inventor constructed a recombinant fusion protein and fused human DR5 with Fc in various ways. The results of mass spectrometry analysis showed that most of the target proteins were cleaved at the N-terminal 11 amino acids (ITQQDLAPQQR). In order to express N The target protein with a relatively uniform terminal was finally screened to remove the intermediate connection sequence and 18 amino acids at the N-terminus on the basis of the commonly used signal peptide of the fusion protein, and named it sDR5-Fc (ZJ501-5). The plasmid was transiently transfected, and the expression supernatant was purified for mass spectrometry and activity analysis.

[0066] DNA sequence of ZJ501-5:

[0067]atgggtgtactgctcacacagaggacgctgctcagtctggtccttgcactcctgtttccaagcatggcgagcatgtccagcccctcagagggattgtgtccacctggacaccatatctcagaagacggtagagattgcatctcctgca...

Embodiment 2

[0071] Example 2 Expression of Human sDR5-Fc Recombinant Protein and Detection of Physicochemical Properties

[0072] The sDR5-Fc / pL101 plasmid was transiently transfected into CHO.K1 cells with Lipofectamine2000, and the supernatant was collected for Dot Blot detection after 48 hours. The result was positive, see figure 2 .

[0073] To recover CHO.K1-S cells, press 5×10 5 / ml 10ml after resuspension, use FreeStyle TM CHO Expression Medium serum-free medium, and add Glutamine at a final concentration of 8mmol / L for culture, placed at 37°C in 8% CO 2 Shake the incubator at 120rpm for cultivation. When the number of cells>1×10 6 Subculture and add liquid to 30ml, maintain cell number 2-5×10 5 / ml, each subsequent passage and maintain the density to 2-5×10 5 / ml, CHO.K1-S needs to be subcultured more than three times.

[0074] The day before transfection, adjust the cell density to 5-6×10 5 / ml 100ml, placed at 37°C 8% CO 2 Shake the incubator at 120rpm for culture, an...

Embodiment 3

[0099] The biological activity identification of embodiment 3ZJ501-5

[0100] (1) Establish a commercial Trail killing activity detection method

[0101] Collect the Jurkat cells in the logarithmic growth phase, resuspend the cells with 10% FCS RPMI-1640 / DMEM after counting, and adjust the cell density to 8*10 4 / ml, 100ul / well was added to a 96-well cell culture plate, and placed in a 37°C, 8% carbon dioxide incubator for 20-24 hours.

[0102] Resuspend the commercial Trail in the above-mentioned complete culture solution containing actinomycin D (final concentration is 0.03ug / ml) at a final concentration of 500-1000ng / ml, and use the complete culture solution containing actinomycin D for 2 times Specific dilution commercial Trail, a total of 15-20 concentration gradients. The diluted sample was added to a 96-well cell culture plate at 100ul / well, and placed in an incubator for 18-22 hours. Add 20ul / well of freshly prepared 20:1 mixed MTS / PMS chromogenic solution, continue...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses application of a human sDR5-Fc recombinant fusion protein in preparation of a medicine for preventing and treating myocardial infarction and ischemia reperfusion injury. A nucleotide sequence for encoding the sDR5-Fc recombinant fusion protein has a) a base sequence as shown in SEQ ID NO: 1, or b) a complementary pairing sequence of SEQ ID NO: 1, or c) a protein having thesame sequence as the nucleotide sequence of a or b, but having a sequence different from the nucleotide sequence of a or b due to the degeneracy of a genetic code; or the amino acid sequence of the sDR5-Fc recombinant fusion protein is shown as SEQ ID NO: 2, or the amino acid sequence of the sDR5-Fc recombinant fusion protein is shown as SEQ ID NO: 2, and one or more amino acids are substituted, but the biological activity is not changed; or the amino acid sequence of the sDR5-Fc recombinant fusion protein is shown as SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5 or SEQ ID NO: 6.

Description

technical field [0001] The invention relates to a recombinant protein, in particular to the application of a human sDR5-Fc recombinant fusion protein in the preparation of medicines for preventing and treating myocardial infarction and myocardial ischemia-reperfusion injury. Background technique [0002] Acute myocardial infarction (AMI) refers to ischemic necrosis of the myocardium, which is based on coronary artery disease, and the blood flow of the coronary arteries is sharply reduced or interrupted, resulting in severe and persistent acute ischemia in the corresponding myocardium. , eventually leading to ischemic necrosis of the myocardium. It is reported that the mortality rate of patients with acute myocardial infarction under the age of 60 is 10.7%, those over the age of 60 are 38.4%, and those over the age of 80 are 50.0%. AMI is one of the main dangerous diseases of cardiovascular diseases. Patients are at high risk of heart failure, shock and arrhythmia, which pos...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): A61K38/17A61K47/68A61K45/06A61K38/49A61K9/00A61P9/10C07K19/00C12N15/62A61K31/21
CPCA61K38/1793A61K47/6803A61K45/06A61K31/21A61K38/49A61K9/0019C12Y304/21073A61P9/10C07K14/70578C07K2319/30A61K2300/00
Inventor 万晓春沈恩允张青梅陈倩胡永强李俊鑫
Owner SHENZHEN ZHONGKE AMSHENN MEDICINE CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com