Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Bifidobacterium longum MF-269 and application thereof

A technology of Bifidobacterium longum and Bifidobacterium, which is applied in the field of microorganisms, can solve problems such as dependence, and achieve the effects of reducing body weight, improving liver function, and reducing visceral fat content

Active Publication Date: 2021-08-10
MEI YI TIAN BIOLOGICAL MEDICINE WUHAN CO LTD
View PDF4 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, common weight-loss drugs on the market have many side effects, such as causing vomiting and diarrhea, insomnia, and dependence. Therefore, there is an urgent need for a drug that has no side effects, can effectively improve the intestinal flora, and then achieve sustainable weight loss and is not easy to rebound

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Bifidobacterium longum MF-269 and application thereof
  • Bifidobacterium longum MF-269 and application thereof
  • Bifidobacterium longum MF-269 and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0023] Isolation, identification and performance measurement of embodiment 1 bacterial strain

[0024] 1. 16S rDNA identification

[0025] Take 5g of feces samples from healthy people, add them into 50mL of sterile water, oscillate and mix, and then serially dilute, spread on MRS+bromocresol purple and MRS+mupirocin lithium salt selective medium plates respectively, place at 37 ℃, anaerobic overnight culture, pick a single colony for purification, and then carry out 16S rDNA strain identification.

[0026] 16S rDNA identification: Genomic DNA extraction, using universal primers:

[0027] 27F: AGAGTTTGATCCTGGCTCAG;

[0028] 1492R: TACGGCTACCTTGTTACGACTT

[0029] The PCR amplification of the 16S rDNA fragment was carried out, and the amplified fragment was submitted to Qingke Biological Company for sequencing. The sequencing result is shown in the sequence table SEQ ID NO:1. After comparison, a strain of Bifidobacterium longum was obtained, which was named Bifidobacterium lo...

Embodiment 2

[0073] Example 2 Lipid-lowering efficacy of Bifidobacterium longum MF-269

[0074] 1. Fat cell experiment

[0075] Cell differentiation induction: when the cell confluency is 70-80%, follow the CL-173 TM Harvest cells by trypsinization according to the subculture-related instructions provided in the product insert. Cells were seeded in preadipocyte expansion medium (90% DMEM, 10% calf serum) and grown for 48 hours, or until the culture reached 100% confluency. After an additional 48 hours of incubation, the preadipocyte expansion medium was removed from each well, and the same volume of differentiation medium (90% DMEM, 10% fetal bovine serum FBS, 1.0 μM dexamethasone, 0.5 mM methyl isobutylxanthine (IBMX), 10 μg / mL insulin). At the same time, according to the ratio of 1:1000, add inactivated bacteria solution.

[0076] Incubate in differentiation medium for 48 hours, replace the differentiation medium with adipocyte maintenance medium (90% DMEM, 10% fetal bovine serum, ...

Embodiment 3

[0090] Example 3 Animal experiment of Bifidobacterium longum MF-269

[0091] 1. Materials

[0092] Bacterial suspension preparation: After the strain was activated and transferred twice, it was cultivated to the stationary phase under suitable culture conditions, 6000rpm / min, centrifuged for 10min to collect the bacterial cells, washed and resuspended with PBS.

[0093] Groups: conventional feed control group, high-fat feed control group (Changzhou Shuyishuer Biotechnology Co., Ltd.), probiotics treatment group, 5 mice in each group.

[0094] 2. Establishment of hyperlipidemia mouse model

[0095] 1) Experimental animals: 8-week-old male C57BL / 6J mice (SPF grade), fed in an environment with a constant temperature of 25±2°C, a relative humidity of 50±5, and a day-night cycle of 12 / 12h.

[0096] 2) After a week of normal diet (ND) adaptation, they were randomly divided into two groups according to body weight. One group was given normal maintenance diet as a blank control, and...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a strain of Bifidobacterium longum MF-269 and application thereof. The Bifidobacterium longum MF-269 is preserved in China General Microbiological Culture Collection Center on January 4, 2021, and the preservation number of the Bifidobacterium longum MF-269 is CGMCC (China General Microbiological Culture Collection Center) No: 21587. The Bifidobacterium longum MF-269 is separated and identified from human excrement for the first time, and research finds that the Bifidobacterium longum MF-269 can remarkably reduce fat cells and reduce the weight of visceral fat, so the effect of reducing the body weight of a mouse is effectively achieved, the content of cholesterol, triglyceride and low-density lipoprotein of the mouse can be reduced, and the liver function is improved; the strain is sourced from healthy human bodies, can produce small molecular acid, has choline salt hydrolase activity and antibiotic resistance, is free of toxic and antigen reaction, can be used as probiotics to prepare multifunctional medicines, functional foods or health foods, and has wide market prospects and application values.

Description

technical field [0001] The invention belongs to the technical field of microorganisms, and in particular relates to a bifidobacterium longum MF-269 and its application. Background technique [0002] Bifidobacterium (Bifidobacterium) is a Gram-positive, non-motile, rod-shaped cells, sometimes forked at one end, strictly anaerobic bacterial genus, widely present in the digestive tract, vagina and oral cavity of humans and animals Bacteria of the genus Bifidobacterium are one of the important members of human and animal intestinal flora. Bifidobacterium is an important intestinal beneficial microorganism that colonizes the human intestine, and there is a close relationship between it and human health and disease. Bifidobacterium longum (Bifidobacterium longum) is a kind of Bifidobacterium genus. It is taken from the healthy human intestine and is beneficial to the human body. It is generally used in food. It has the ability to regulate the human intestinal tract and improve he...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/20A61K35/745A61P3/06A61P3/04A61P1/16A23L33/135C12R1/01
CPCC12N1/20A61K35/745A61P3/06A61P3/04A61P1/16A23L33/135A23V2002/00A23V2400/533A23V2200/3262A23V2200/332A23V2200/30
Inventor 刘庆军沈鹤霄李国龙张帆
Owner MEI YI TIAN BIOLOGICAL MEDICINE WUHAN CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com