Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Kit for detecting serum anti-Annexin A2-IgG antibody

A kit and serum technology, applied in the biological field, can solve the problems of difficult research, few podocytes, and the inability of primary cells to proliferate, and achieve the effects of improving accuracy and specificity, easy operation, and improving the positive detection rate.

Active Publication Date: 2020-02-28
ZHEJIANG UNIV
View PDF9 Cites 13 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the special anatomical location of podocytes makes it difficult to study in vivo; and because the renal podocytes of normal adult organisms are terminally differentiated cells, primary cells cultured in vitro cannot proliferate.
Therefore, the in vitro research work on podocytes in the past was very little

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Kit for detecting serum anti-Annexin A2-IgG antibody
  • Kit for detecting serum anti-Annexin A2-IgG antibody
  • Kit for detecting serum anti-Annexin A2-IgG antibody

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0057] Embodiment 1, prokaryotic expression and purification of Annexin A 2 The antigen was obtained from GenBank (CM-000677.2) encoding human Annexin A 2 The cDNA partial sequence of the gene (chromosome15, 101bp from base60347151-60347252:-TGATTTTATTTTATTTTATTTCATTTAAATTTAACTTAAATAGCGACACTTGGATAGGGGCAACCATACTGTACAGCTCAGTCCCGAGCTTTCTTCCTACA-) was used to design primers. GAATTC TGATTTTATTTTATTTTA-3' (underlined with EcoRI Restriction site), downstream 5′- GGATCC AGTAGGAAGAAAGCT-3' (the underline contains BamHI Restriction site), connected with pMD19-T vector, transformed JM109 competent cells, picked monoclonal colonies, and sent to the company for sequencing after preliminary identification by colony PCR and double enzyme digestion. To connect successfully Annexin A 2 -PMD19-T was digested with EcoRI / BamHI double enzymes, the target fragment was recovered, connected with pET28a after the same double enzyme digestion, and pET28a-Annexin A 2 The plasmid was transformed...

Embodiment 2

[0058] Embodiment 2, anti-Annexin A 2 - Preparation of IgG antibody standard

[0059] 2.1 Anti-Annexin A 2 -Extraction of IgG antibody Through our preliminary experiments, a higher content of anti-Annexin A was screened out 2 -IgG antibody serum, then diluted 1:200, take 100ul and add to Annexin A 2 In the coated reaction wells, there are a total of 6 wells. At the same time, add 100ul of reaction buffer to 2 more wells to eliminate non-specific adsorption. Shake and react at 37°C for 2 hours, wash with washing solution for 3 times, and add 100ul of 6mol to 3 wells. Urea, shaking and reacting at 37°C for 20 minutes, so that the specific IgG dissociates into the urea solution, extracts the urea solution and detects the content of IgG dissolved in it, then continues to wash the 3 wells for 2 times, and further conducts anti-assay with the remaining 5 wells. Annexin A 2 - Detection of IgG antibody to analyze whether it contains undissociated IgG antibody and its proportion, s...

Embodiment 3

[0061] Embodiment 3, for detecting anti-Annexin A 2 - Preparation of IgG solid-phase membrane immunoassay kit

[0062] 3.1. Used to detect anti-Annexin A 2 -IgG solid-phase membrane immunoassay kit composition:

[0063] 1. Coated with Annexin A 2 Antigen nitrocellulose membrane,

[0064] 2. Positive quality control (standard product) human anti-His tag immunoglobulin G (purchased from Tribioscience) 3. Negative quality control (antibody diluent)

[0065] 4. Horseradish peroxidase-labeled goat anti-human immunoglobulin G

[0066] 5. Antigen diluent

[0067] 6. Washing liquid

[0068] 7. TMB developer

[0069] 8. Termination solution.

[0070] 3.2. The preparation of antigen-coated nitrocellulose membrane and the detection steps of serum samples are as follows:

[0071] 3.2.1 Coating and blocking: Spot 5 μl of the antigen solution diluted with 0.01M PBS pH7.4 directly on the nitrocellulose membrane and dry it in a 37°C incubator for 30 minutes, place the NC membrane in ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a kit for detecting a serum anti-Annexin A2-IgG antibody. The detection kit of the invention adopts a target antigen Annexin A2 corresponding to an anti-Annexin A2-IgG antibodyof a primary nephrotic syndrome-related biomarker, uses human anti-tag peptide IgG as a standard substance for quantitative detection, and utilizes a biotin-labeled detection antibody and an enzyme-labeled streptavidin amplification system, thereby improving the accuracy and sensitivity of serum anti-Annexin A2-IgG antibody detection, and providing a better detection method for the diagnosis and treatment of primary nephrotic syndrome with the anti-Annexin A2-IgG antibody.

Description

technical field [0001] The invention belongs to the field of biotechnology, and relates to a method for detecting serum anti-Annexin A 2 - Kits for IgG antibodies. It is a fast, simple and highly sensitive qualitative or quantitative analysis of anti-Annexin A in human serum 2 - Detection kits for IgG levels. [0002] technical background [0003] In recent years, there are more and more types of kidney diseases in children, among which primary nephrotic syndrome has the highest incidence rate, which seriously endangers children's physical and mental health. Primary nephrotic syndrome is caused by a variety of causes of renal function damage and the symptoms of "three highs and one low" at the same time, that is, a syndrome of massive proteinuria, high edema, hyperlipidemia and hypoalbuminemia. The etiology and pathogenesis of primary nephrotic syndrome are still unclear at present, and mainly include the following factors: 1. Filtration barrier damage, deposition of immun...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): G01N33/68G01N33/544G01N33/543
CPCG01N33/54306G01N33/54326G01N33/544G01N33/6893G01N2333/4701G01N2800/347
Inventor 叶青毛建华田丹丹
Owner ZHEJIANG UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com