Colon targeting recombinant toxin as well as preparation method and application thereof
A technology for recombining toxin proteins and toxins, which is applied in the fields of peptide preparation methods, chemical instruments and methods, recombinant DNA technology, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0057] express rCCK 96-104 Construction of PE38KDEL Recombinant Strain
[0058] (1) Using pET-rG17PE38KDEL as a template, reverse CCK 96-104 The fragment gene is fused with the PE38KDEL gene, and rTEV-specific cleavage sites are introduced, and the artificially synthesized primers are:
[0059] F1: TTCGACATGTGGGGGCATGTATGACCATATGGCCGAAGAGGGC
[0060] F2: GCTAGC GAAAACCTGTATTTTTCAGGGCTTCGACATGTGGGGCATG
[0061] R: GGATCC TTACAGCTCGTCCTTCGGCG
[0062] PCR conditions: pre-denaturation at 94°C for 5min, denaturation at 94°C for 45s, annealing at 62°C for 30s, extension at 72°C for 1min, extension at 72°C for 10min, 32 cycles.
[0063] (2) The amplified product was identified by 1% agarose gel electrophoresis, and a bright band appeared above approximately 1000 bp. The band was recovered using a gel recovery kit and stored at -20°C.
[0064] (3) Construction of the cloning vector: Mix the recovered gene and the pMD-18T vector at a ratio of 4:1, then add an equal volume of ...
Embodiment 2
[0068] Prokaryotic expression and induction condition optimization
[0069] (1) Prokaryotic expression
[0070] The screened monoclonal recombinant engineered strains were inoculated into LB medium (Kana) with 1% inoculum, and cultured at 37°C at 180r until the bacterial solution OD 600 When it was 0.4, add the inducer IPTG to the final concentration of 1M, continue to cultivate under the same conditions for 5 hours, take 1 mL of the bacterial liquid at 4 °C, centrifuge at 10000r for 15 min, add 80 μL of PBS, 20 μL of 5×SDS-PAGE Loading Buffer, boil in water for 10 min, pass through 10 %SDS-PAGE electrophoresis verification expression (recombinant protein molecular weight 39kDa, attached figure 2 );
[0071] (2) western-blotting analysis of recombinant protein
[0072] Configure 10% SDS-PAGE electrophoresis gel, add 10 μL of the above-mentioned prepared bacterial sample to each well, and perform SDS-PAGE electrophoresis; press the transfer device from bottom to top for the...
Embodiment 4
[0085] Protein Purification Strategy
[0086] (1) Ultrasonic crushing
[0087] Induce expression according to the optimized fermentation conditions, centrifuge the bacterial solution at low temperature and high speed for 15min (10000r, 4°C), discard the supernatant, add an equal amount of PBS to resuspend, centrifuge to remove the supernatant (10000r, 4°C, 15min), repeat Twice to wash the cells. Add 15mL PBS per 1g of bacteria and resuspend with PBS (containing 1mg / mL lysozyme), and then use an ultrasonic breaker to break up the bacteria (total ultrasonic time 30min, power 380W, working time 1s, interval 4s). Centrifuge at low temperature and high speed (10000r, 4°C, 1h), discard the precipitate, filter the supernatant with a 0.22μm filter, and store it at 4°C for short-term storage;
[0088] (2) Ni-NTA affinity chromatography
[0089] Use the AKTA purifier 100 purification instrument for purification, first turn on the AKTA purifier 100 purification system, connect the chr...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap