Clone, expression and biological activity of stingray caudal spine cyclophilin A gene

An amino acid, a technology in the sequence table, applied in the directions of sugar derivatives, biochemical equipment and methods, and microbial determination/inspection, to achieve high application prospects and industrial development value.

Inactive Publication Date: 2003-07-09
北京博奥环宇生物技术有限公司
View PDF0 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Therefore, although CsA has the function of suppressing the immune response, it still has a certain prospect in the treatment of AIDS.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Clone, expression and biological activity of stingray caudal spine cyclophilin A gene
  • Clone, expression and biological activity of stingray caudal spine cyclophilin A gene
  • Clone, expression and biological activity of stingray caudal spine cyclophilin A gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0048] Example 1 Extraction, library construction and PCR clone screening of red ray tail thorn total RNA

[0049] Extraction of total RNA and synthesis of cDNA: Dissect the tail spines of two red stingrays, extract the total RNA of the tentacles by the guanidine isothiocyanate method, and remove the protein by phenol / chloroform extraction. Obtain 65 μg of tail spines total RNA, the A 260 / A 280 = 1.98, two clear bands of 28s and 18s can be seen through 1% formaldehyde denaturing gel electrophoresis detection, the ratio> 2, and mRNA smear (see figure 1 ), indicating that the integrity of total RNA was good. Perform first-strand synthesis, LD PCR cDNA amplification, enzyme digestion and column recovery of cDNA, and construct a cDNA library.

[0050] Primer design and PCR amplification: According to the cyclophilin (CyP) EST 3' end and carrier nucleotide sequence obtained from the random sequencing results of a small number of clones in the library, design primers, T7 primer:...

Embodiment 2

[0050] Primer design and PCR amplification: According to the cyclophilin (CyP) EST 3' end and carrier nucleotide sequence obtained from the random sequencing results of a small number of clones in the library, design primers, T7 primer: 5'-TAA TAC GAC TCACTA TA-3 '; CyPA primer: 5'-TTG TTC CCA AAC AAT CAC-3'. For every 50 μl PCR reaction volume, add 1 μl of the total library plasmid as a template, perform PCR amplification, and detect by electrophoresis. It is found that the expected specific amplification band appears around 650 bp (see figure 2 ), recycle the belt. Determination and analysis of embodiment 2 recombination red ray sting CypA gene sequence

[0051] The recovered electrophoresis products were connected to the T-easy vector, transformed into DH5 α Escherichia coli, and the recombinant clones were selected for sequencing. A total of 12 clones were determined, and Blast homology analysis showed that 7 of them were cyclophilin A gene sequences, and the length of ...

Embodiment 3

[0078] In the PCR amplification reaction, about 10 -4 Due to the small size of the target fragment, the number of PCR cycles does not exceed 30, which reduces the probability of wrong inclusion. From the experimental results, this sequence is repeated in multiple clone sequencing, and the wrong inclusion can be ruled out. The results of experimental PCR have high reliability. Embodiment 3 Construction of recombinant red ray tail thorn cyclophilin A protein expression plasmid

[0079] A pair of primers were synthesized according to the two ends of the cyclophilin A gene of the red ray stingray, and a KpnI restriction site (GGTACC), ATG initiation codon, and a Prescission Protease cleavage site were introduced into the upstream primer, and a Prescission Protease cleavage site was introduced into the downstream primer Introduce BamH I restriction site (GGATCC) and stop codon TTA, TCA.

[0080] Upstream primer (P1): 5'-GG GGTACC CTGGAAGTTCTGTTCCAAGGTCCA ATG

[0081] ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

PropertyMeasurementUnit
Gene lengthaaaaaaaaaa
Login to view more

Abstract

The present invention utilizes the construction of dasytis akajei caudal spine cDNA library and DNA sequencing and designs the primer according to the obtained (CyP) EST 3' end and carrier nucleotide sequence, and uses PCR method to screen the dasytis akajei caudal spine cDNA library and clone the cyclophilin A total strength gene. The tength of new gene is 656 bp for coding mature peptide of 167 amino acids, the isoelectric point of the expressed protein is 8.34, and the molecular weight is 18,021 Dalton. The dasytis akajei caudal spine cyclophilin A gene is cloned in the uxA gene 3' tail end of thioredoxing gene fusion expression vector pTRX and the fusion gene meeting reading frame is construcled, said fusion protein is existed in colibacillus, its expression amount can be up to 60 mg / L.

Description

technical field [0001] The invention relates to the cloning, expression and biological activity of the red ray tail thorn cyclophilin A (cyclophilin A) gene. More specifically, the present invention relates to starting from the total plasmid of the cDNA expression library of the red stingray stingray, using the PCR method to screen and clone the full-length CypA gene, and using the method of genetic engineering to express and purify the CypA gene with biological activity in a high-efficiency Escherichia coli expression system. The red ray tail sting cyclophilin A protein, through the identification of peptidyl proline cis-trans isomerase activity of the recombinant red ray cyclophilin A protein and the research on the binding affinity with cyclosporine A (CsA), etc., Confirm its activity, and use it as a drug target to screen small molecular compounds and traditional Chinese medicine components that can bind to it with high affinity, laying the foundation for the screening of ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C07H21/04C07K14/435C12N15/64C12N15/70C12P19/34C12P21/02C12Q1/10C12Q1/18
Inventor 徐安龙涂洪斌熊茜
Owner 北京博奥环宇生物技术有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products