Clone, expression and biological activity of stingray caudal spine cyclophilin A gene
An amino acid, a technology in the sequence table, applied in the directions of sugar derivatives, biochemical equipment and methods, and microbial determination/inspection, to achieve high application prospects and industrial development value.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0048] Example 1 Extraction, library construction and PCR clone screening of red ray tail thorn total RNA
[0049] Extraction of total RNA and synthesis of cDNA: Dissect the tail spines of two red stingrays, extract the total RNA of the tentacles by the guanidine isothiocyanate method, and remove the protein by phenol / chloroform extraction. Obtain 65 μg of tail spines total RNA, the A 260 / A 280 = 1.98, two clear bands of 28s and 18s can be seen through 1% formaldehyde denaturing gel electrophoresis detection, the ratio> 2, and mRNA smear (see figure 1 ), indicating that the integrity of total RNA was good. Perform first-strand synthesis, LD PCR cDNA amplification, enzyme digestion and column recovery of cDNA, and construct a cDNA library.
[0050] Primer design and PCR amplification: According to the cyclophilin (CyP) EST 3' end and carrier nucleotide sequence obtained from the random sequencing results of a small number of clones in the library, design primers, T7 primer:...
Embodiment 2
[0050] Primer design and PCR amplification: According to the cyclophilin (CyP) EST 3' end and carrier nucleotide sequence obtained from the random sequencing results of a small number of clones in the library, design primers, T7 primer: 5'-TAA TAC GAC TCACTA TA-3 '; CyPA primer: 5'-TTG TTC CCA AAC AAT CAC-3'. For every 50 μl PCR reaction volume, add 1 μl of the total library plasmid as a template, perform PCR amplification, and detect by electrophoresis. It is found that the expected specific amplification band appears around 650 bp (see figure 2 ), recycle the belt. Determination and analysis of embodiment 2 recombination red ray sting CypA gene sequence
[0051] The recovered electrophoresis products were connected to the T-easy vector, transformed into DH5 α Escherichia coli, and the recombinant clones were selected for sequencing. A total of 12 clones were determined, and Blast homology analysis showed that 7 of them were cyclophilin A gene sequences, and the length of ...
Embodiment 3
[0078] In the PCR amplification reaction, about 10 -4 Due to the small size of the target fragment, the number of PCR cycles does not exceed 30, which reduces the probability of wrong inclusion. From the experimental results, this sequence is repeated in multiple clone sequencing, and the wrong inclusion can be ruled out. The results of experimental PCR have high reliability. Embodiment 3 Construction of recombinant red ray tail thorn cyclophilin A protein expression plasmid
[0079] A pair of primers were synthesized according to the two ends of the cyclophilin A gene of the red ray stingray, and a KpnI restriction site (GGTACC), ATG initiation codon, and a Prescission Protease cleavage site were introduced into the upstream primer, and a Prescission Protease cleavage site was introduced into the downstream primer Introduce BamH I restriction site (GGATCC) and stop codon TTA, TCA.
[0080] Upstream primer (P1): 5'-GG GGTACC CTGGAAGTTCTGTTCCAAGGTCCA ATG
[0081] ...
PUM
Property | Measurement | Unit |
---|---|---|
Gene length | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap