Recombinant protein as well as expression method, purification method and application thereof

A technology of recombinant protein and expression method, which is applied in peptide preparation methods, chemical instruments and methods, recombinant DNA technology, etc., can solve the problems of easy loss of activity and low yield of F protein, achieve high-level expression, and facilitate protein purification Effect

Pending Publication Date: 2022-07-01
LANZHOU INST OF BIOLOGICAL PROD
View PDF4 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] Since the F protein is an envelope protein, the F protein can be obtained by culturing the virus in vitro and cracking the virus, but its yield is low; and it is easy to lose its activity during the purification process of the F protein

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant protein as well as expression method, purification method and application thereof
  • Recombinant protein as well as expression method, purification method and application thereof
  • Recombinant protein as well as expression method, purification method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0087] Embodiment 1, the expression method of RSV-F recombinant protein

[0088] 1. Amplification of RSV-F coding fragment

[0089] The amplification of the RSV-F coding fragment takes the optimized RSV-F nucleotide sequence as the template, and PCR amplifies the RSV-F fragment;

[0090] specifically,

[0091] The RSV-F nucleotide sequence is nt94-nt1563 of SEQ ID No.1 of the sequence listing;

[0092] specifically,

[0093] Take the optimized sequence of the natural fusion protein gene coding sequence of the Long strain of wild-type RSV as a template, and design the following primers according to the optimized sequence:

[0094] F-f GAA ACCGGT CAGAATATCACCGAGGAGTTC(Age I)

[0095] F-r CTT GGTACC TCATTACAGCAGCTCATCGGACTTCC(KpnI)

[0096] Amplify the gene sequence of the extracellular region (AA26-AA512) without the signal peptide of the RSV-F protein, that is, the gene open reading frame nt94-nt1557;

[0097] specifically,

[0098] PCR reaction conditions: pre-denat...

Embodiment 2

[0134] Embodiment 2, the purification method of RSV-F recombinant protein

[0135] The RSV-F recombinant protein expressed in Example 1 was purified, and the purification steps were:

[0136] 1. Anion exchange purification: use Capto Q anion exchange column for purification, first use 15 times the column volume of binding buffer A (0.04M NaH 2 PO 4 , 0.06M Na 2 HPO 4 , pH 7.0) to equilibrate the column; then dilute the concentrated solution of the culture supernatant containing the target protein with buffer A, and adjust the pH of the sample to be the same as the pH of the buffer; load the sample with the sample pump, and set the sample volume (500ml) , flow rate (3ml / min), pre-column pressure (0.3MPa), column pressure difference (0.2MPa) and other parameters, make the sample flow through the column under the set conditions, and collect the flow-through liquid for SDS-PAGE analysis. Chromatograms such as Figure 5 As shown, the electropherogram is shown in Figure 8 sho...

Embodiment 3

[0139] Embodiment 3, analyze the purity of RSV-F recombinant protein

[0140] 1. Determination of protein content by BCA method

[0141] Standard protein BSA (2 mg / ml) was diluted in PBS to prepare standard series of 0, 25, 125, 250, 500, 750 and 1000 [mu]g / ml. Take 4ul of each series of standards and purified samples of appropriately diluted recombinant proteins and add them to the standard wells of a 96-well plate, add 200ml of BCA working solution to each well, place at room temperature for 5min, and measure the absorbance at 595nm with a microplate reader. Draw a standard curve (y=1.2787x-0.516) with the standard concentration and absorbance, where y is the protein concentration, x is the absorbance, and the sample concentration is calculated.

[0142] 2. Analysis of protein purity with a grayscale scanner

[0143] The expressed target protein was purified, and the target protein harvested after three-step purification was subjected to SDS-PAGE, and the purity of the exp...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to a recombinant protein as well as an expression method, a purification method and application thereof. The recombinant protein is an F protein of RSV, namely RSV-F, the nucleotide sequence of the RSV-F is SEQ ID No.1 in a sequence table, and the amino acid sequence of the RSV-F protein is SEQ ID No.2 in the sequence table. The expression method of the recombinant protein comprises the following steps: 1) amplifying an RSV-F coding fragment; (2) constructing a subcloning plasmid containing F protein according to the amplified RSV-F coding fragment; (3) constructing eukaryotic expression plasmids of the RSV-F according to the subcloning plasmids; and 4) transfecting the eukaryotic expression plasmid of the RSV-F into an HEK293E cell, and culturing in a culture medium. The recombinant protein is purified by anion exchange column purification, cation exchange column purification and gel filtration chromatographic column purification. The purified RSV-F recombinant protein has immunogenicity and can be used for research and development of RSV subunit vaccines or immunodiagnosis of RSV infection.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a recombinant protein and its expression method, purification method and application. Background technique [0002] Respiratory syncytial virus (RSV) is the most important pathogen causing acute lower respiratory tract disease in infants and young children. Worldwide, more than 34 million children under the age of 5 are infected with RSV every year, of which about 3.4 million are hospitalized and 160,000-200,000 die, and 99% of the fatal cases of RSV infection occur in low- and middle-income developing countries. Infants up to 24 months of age are almost all infected with RSV once, and all children under 3 years of age are infected with RSV and are reinfected many times throughout their lives. Globally, RSV causes 6.7% of infants and children under the age of 1 mortality, and is the second leading cause of death after malaria. In addition, the elderly and immunocompromi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C07K19/00C12N15/85C07K1/18C07K1/16A61K39/155A61P31/14G01N33/569
CPCC07K14/005C12N15/85A61K39/12A61P31/14G01N33/56983C12N2760/18522C12N2760/18534C07K2319/02C07K2319/036C12N2800/107G01N2333/135
Inventor 朱传凤瓦晓霞马超李雄雄傅生芳王婉
Owner LANZHOU INST OF BIOLOGICAL PROD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap