Mutated Aspergillus oryzae strain

A technology of Aspergillus oryzae and strain, applied in the field of microorganisms, can solve problems such as low expression

Pending Publication Date: 2021-09-17
WILMAR SHANGHAI BIOTECH RES & DEV CENT
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, according to the existing literature, the heterologous expression of lipase for food by Aspergillus oryzae often has a very low expression level, for example: Wang Bin in Aspergillus oryzae auxotrophic host bacteria ( Aspergillus oryzae niaD300 , niaD- ) expressed Rhizopus miehei ( Rhizomucor miehei ) source of lipase RML, the supernatant of the 7-day culture was taken, and the enzyme activity was determined by alkali titration to only 2.5 U / mL (Wang Bin, Pan Li, Guo Yong. Filamentous fungus Aspergillus oryzae exogenous gene expression system Construction. Journal of South China University of Technology, 2009, 37(6): 84-90), therefore, cannot meet the needs of the industry

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Mutated Aspergillus oryzae strain
  • Mutated Aspergillus oryzae strain
  • Mutated Aspergillus oryzae strain

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] Embodiment 1: Obtaining of orotidine-5' phosphate decarboxylase auxotrophic Aspergillus oryzae strain

[0034] With reference to patent CN201310288060.3, the spores of Aspergillus oryzae CICC2012 were inoculated and coated on MM solid medium (1% glucose, 0.15% KH) added with 0.04% inositol 2 PO 4 , 0.6% NaNO 3 , 0.05% KCl, 0.05% MgSO 4 , 2% agar powder), 28 ℃, static culture for 5 days, to obtain enriched monokaryotic Aspergillus oryzae spores. Fresh spores of Aspergillus oryzae CICC2012 were eluted with spore washing solution (0.9% NaCl, 0.05% Tween 80), filtered through Miracloth (Calbiochem, Cat# 475885) to prepare a spore suspension, and the cells were washed twice with sterile water and dried. Adjust to 1×10 7 individual / mL. Take 2 mL of spore suspension and evenly disperse it on the surface of the petri dish, place it under the ultra-clean workbench and irradiate it with ultraviolet light for 90 s, take 100 μL and apply it to the culture dish supplemented wi...

Embodiment 2

[0035] Embodiment 2: Construction of RML expression vector

[0036] Exogenous Rhizomucor miehei ( Rhizomucor miehei ) lipase (RML) gene sequence is as follows.

[0037] Nucleic acid sequence:

[0038] gtgccaatcaagagacaatcaaacagcacggtggatagtctgccacccctcatcccctctcgaacctcggcaccttcatcatcaccaagcacaaccgaccctgaagctccagccatgagtcgcaatggaccgctgccctcggatgtagagactaaatatggcatggctttgaatgctacttcctatccggattctgtggtccaagcaatgagcattgatggtggtatccgcgctgcgacctcgcaagaaatcaatgaattgacttattacactacactatctgccaactcgtactgccgcactgtcattcctggagctacctgggactgtatccactgtgatgcaacggaggatctcaagattatcaagacttggagcacgctcatctatgatacaaatgcaatggttgcacgtggtgacagcgaaaaaactatctatatcgttttccgaggttcgagctctatccgcaactggattgctgatctcacctttgtgccagtttcatatcctccggtcagtggtacaaaagtacacaagggattcctggacagttacggggaagttcaaaacgagcttgttgctactgttcttgatcaattcaagcaatatccaagctacaaggttgctgttacaggtcactcactcggtggtgctactgcgttgctttgcgccctgggtctctatcaacgagaagaaggactctcatccagcaacttgttcctttacactcaaggtcaaccacgggtaggcgaccctgcctttgccaactacgttgttagcaccggcatt...

Embodiment 3

[0043] Embodiment 3: Aspergillus oryzae PyrG L4 replenishment experiment

[0044] Fresh Aspergillus oryzae PyrG L4 spores were eluted with spore washing solution (0.9% NaCl, 0.05% Tween 80), filtered through Miracloth to prepare a spore suspension, and adjusted to 1 × 10 7 individual / mL. Inoculate 1mL of spore suspension into mycelia medium (2% tryptone, 1% yeast extract, 2% glucose, 0.3% uracil), culture at 28°C, 180rpm for 40 hours, and collect by sterilizing Miracloth filter growing hyphae.

[0045] The collected hyphae were sterilized with osmotic pressure stabilizer (0.6 M MgSO 4 , 10mM NaH 2 PO 4 , pH=5.8) washed three times and pressed dry. Mycelium was transferred to a 100mL Erlenmeyer flask. Resuspend every 0.8g mycelium in 20mL enzymolysis solution (use osmotic pressure stabilizer to prepare 1% lyase, 1% cellulase, 0.1% helicase enzymolysis solution, filter through 0.22 μm microporous membrane Bacteria), at 30°C, 90 rpm, for 60-90min. The enzymatically hydro...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The present invention relates to a mutated Aspergillus oryzae strain. Specifically, the invention relates to a mutated Aspergillus oryzae strain of which the productivity is improved by being compared with a non-mutated strain, endogenous enzymes, such as amylase and / or foreign protein, and food-purpose lipase, preferably the food-purpose lipase selected from rhizomucor miehei lipase, thermomyces lanuginosus lipase and fusarium oxysporum lipase. The invention also relates to various applications of the strain.

Description

technical field [0001] The invention relates to the field of microbes, and more specifically relates to a mutant Aspergillus oryzae strain, a recombinant strain obtained by using the strain, a biocatalyst, etc., and a method for producing exogenous protein by using the strain. Background technique [0002] Aspergillus oryzae ( Aspergillus oryzae ) is a commonly used bacterial strain in the fermentation industry. The history of Aspergillus oryzae producing soy sauce, bean miso, sake and many other fermented foods can be traced back to more than 1,000 years ago. Recognized (MachidaM. Progress of Aspergillus oryzae genomics. AdvAppl Microbio, l 2002, 51: 81, 106), it is a very commonly used species in filamentous fungi, and is widely used in food brewing industry and industrial enzyme preparation industry. [0003] Aspergillus oryzae is a strain capable of producing complex enzymes, including amylase, protease, lipase, pectinase, phytase, etc., and Aspergillus oryzae also has...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N1/21C12N9/20C12N15/80C12R1/69
CPCC12N9/20C12Y301/01003C12N15/80
Inventor 吴伟戴小军曹海生牛其文
Owner WILMAR SHANGHAI BIOTECH RES & DEV CENT
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap