Natural immunosuppressive gene deleted attenuated African swine fever virus strain and application
A technology of African swine fever virus and African swine fever, which is applied in the field of bioengineering, can solve the problems of high cost, many virulence genes knocked out, safety problems, etc., achieve good safety performance, promote the production of interferon, reduce the toxic effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0055] Example 1 Construction and purification identification of recombinant virus MGF-Δ9L
[0056] 1. CRISPR / Cas9 vector construction
[0057] (1) pX330 vector optimization: Since African swine fever virus mainly replicates in the cytoplasmic virus factory, pX330 was first optimized when constructing the pCRISPR / Cas9 vector; the Cas9 enzyme at both ends was removed by the ClonExpress II one-step cloning method. Nuclear localization signal (NLS), designated pX330ΔN.
[0058] (2) Design targeting gRNAs for ASFV MGF-110-9L gene, its oligonucleotide name and sequence are respectively: MGF1109L-gRNA-LF: CTCCTGTTCCTGGAAAAGATTGG' (shown in SEQ ID NO.3) and MGF1 109L-gRNA -RF: TTAATTGTACAGTTTCCCGGTGG (shown in SEQ ID NO. 4).
[0059](3) Referring to the cloning method recommended by the literature (Ran FA, Hsu PD, Wright J, Agarwala V, Scott DA, Zhang F. Genomeengineering using the CRISPR-Cas9system. NatProtoc. 2013; 8(11): 2281-2308), the The oligonucleotides MGF1109L-gRNA-LF and...
Embodiment 2
[0071] Example 2 ASFV MGF-110-9L immunosuppressive experiment
[0072] HEK293 cells in good condition were digested with trypsin and spread on a 48-well plate, placed at 37°C, 5% CO 2 Cells were cultured in an incubator for 12 hours, and Lipofectamine TM 2000 transfection was performed when the cell density was nearly 70%-80%. 100ng of IFN-β reporter plasmid, 10ng of internal reference TK, and 100ng of MGF-110-9L plasmid ( The ASFV MGF-110-9L gene was inserted into the PCMV plasmid to obtain the PCMV-MGF-110-9L plasmid) and simultaneously transfected into HEK293 cells. After 24 hours of transfection, the successfully transfected cells were retransfected with HT-DNA (1 μg / mL), transfected for 12h. At least three parallel holes were set up in the experiment to ensure the reliability of the experimental results. Add 50 μL of 1×passive lysis buffer to each well to lyse at room temperature for 15-20min, and detect the activity of the dual luciferase reporter gene after sufficien...
Embodiment 3
[0073] The titration of embodiment 3 virus titers
[0074] The titration of African swine fever virus adopts the half hematosorbate amount (50% haemadsorption, HAD 50 ) method to operate. References (Borca MV, Ramirez-Medina E, Silva E, Vuono E, Rai A, Pruitt S, Holinka LG, Velazquez-Salinas L, Zhu J, Gladue DP. Development of a highly effective African swine feve r virus vaccine by deletion of the I177L genes results in sterile immunity against the current epidemic Eurasiastrain.JVirol.2020.pii:JVI.02017-19) for HAD 50Experimental operation, and make appropriate adjustments: Inoculate primary PBMCs in 96-well cell culture plates (Mason, D.W., W.J.Penhale, and J.D.Sedgwick, 1987: Preparation of lymphocytes subpopulations. In: Klaus, G.G.B. (ed.) Lymphocytes: aPractical Approach, pp.35-54.IRL Press, Oxford.), carry out 10-fold gradient dilution of the sample to be tested, and inoculate 0.02ml in each hole, and the virus infection can be judged according to the rosette formed ...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com