Chickenpox-zoster virus glycoprotein E gene expression vector, recombinant yeast strain thereof and application thereof
A herpes zoster virus, gene expression technology, applied in the field of genetic engineering, to achieve the effect of high-efficiency expression
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0060] Preparation and construction method of embodiment 1 recombinant vector
[0061] 1. Synthesis of VZV gE gene sequence
[0062] According to the yeast codon preference, the original sequence of gE was codon-optimized without changing the amino acid sequence to obtain the gene nucleotide sequence SEQ ID NO.1.
[0063] SEQ ID NO.1:
[0064] ATGGGGACAGTTAATAAACCTGTGGTGGGGGTATTGATGGGGTTCGGAATTATCACGGGAACGTTGCGTATAACGAATCCGGTCAGAGCATCCGTCTTGCGATACGATGATTTTCACATCGATGAAGACAAACTGGATACAAACTCCGTATATGAGCCTTACTACCATTCAGATCATGCGGAGTCTTCATGGGTAAATCGGGGAGAGTCTTCGCGAAAAGCGTACGATCATAACTCACCTTATATATGGCCACGTAATGATTATGATGGATTTTTAGAGAACGCACACGAACACCATGGGGTGTATAATCAGGGCCGTGGTATCGATAGCGGGGAACGGTTAATGCAACCCACACAAATGTCTGCACAGGAGGATCTTGGGGACGATACGGGCATCCACGTTATCCCTACGTTAAACGGCGATGACAGACATAAAATTGTAAATGTGGACCAACGTCAATACGGTGACGTGTTTAAAGGAGATCTTAATCCAAAACCCCAAGGCCAAAGACTCATTGAGGTGTCAGTGGAAGAAAATCACCCGTTTACTTTACGCGCACCGATTCAGCGGATTTATGGAGTCCGGTACACCGAGACTTGGAGCTTTTTGCCGTCATTAACCTGTACGGGAGACGCAGCGCCCGCC...
Embodiment 2
[0073] Example 2 Preparation of recombinant yeast strain and its expression detection
[0074] 1. Transformation of recombinant plasmid pGAPZαA-gE yeast strain
[0075] The recombinant plasmid pGAPZαA-gE obtained in Example 1 was transformed into Escherichia coli DH5α, a single colony was picked for shaking flask culture, and a large number of plasmids were extracted, and the single colony prevailed. The extracted recombinant plasmid pGAPZαA-gE was linearized and single-digested with the restriction endonuclease Avr II. After the linearization of the restriction endonuclease was detected by agarose gel electrophoresis, the digested vector was gel-recovered.
[0076] Fresh X33 yeast competent cells were prepared, and the linearized vector was electrotransformed into X33 yeast competent cells. At the same time, the linearized pGAPZαA empty vector was transformed as a control. The electroporation conditions were: 2000V, 25μF, 400Ω, electroporation for 5ms. After electric shock, ...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com