Method for producing 1,3-propylene glycol through fermentation via recombinant microbes
A technology for recombining microorganisms and propylene glycol, applied in the fields of genetic engineering and biological fermentation, can solve the problems of poor biosafety of Escherichia coli, complicated post-extraction process, unfavorable large-scale production, etc. less effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0034] Example 1 Overexpression of the dihydroxyacetone phosphate phosphatase gene and the glycerol dehydrogenase gene gldA derived from Escherichia coli
[0035] Using the genome of Corynebacterium glutamicum ATCC 13032 as a template, primers hdpA-F (cagctatgaccatgattacgATAAGGCTGATTAGCGGGAAAATTTCG) and hdpA-R (CCAGTCGTGTCTAGTCAGTGAACTGCTGCTCATCT) were used as primers to perform PCR to obtain hdpA gene (hdpA gene sequence such as SEQ ID NO.1) about 0.9kb And perform PCR product purification.
[0036] Using the genome of Escherichia coli MG1655 as a template, PCR was performed with primers gldA-F (CACTGACTAGACACGACTGGAATGCCGC) and gldA-R (atccccgggtaccgagctcgttaTTCCCACTCTTGCAGGAAACGC) as primers to obtain about 1.2 kb of the gldA gene (gldA gene sequence such as SEQ ID NO.2) and perform PCR product purification.
[0037] The Escherichia coli-Corynebacterium glutamicum shuttle plasmid pEC-K18mob2 (Journal of Biotechnology 104 (2003) 287-299) was digested with EcoRI, and the hpd...
Embodiment 2
[0039] Example 2 Overexpression of glycerol dehydratase derived from Klebsiella pneumoniae and its activator pduCDEGH and alcohol dehydrogenase gene yqhD from Escherichia coli
[0040] Using the genome of Klebsiella pneumoniae HR526 as a template, primers pdu-F (CGCCCGCtaaAAGGAGATACCATGAGATCGAAAAGATTTGAAG) and pdu-R (tgcctgcaggtcgactctagTTAAGCATGGCG) were used as primers to carry out PCR to obtain a pduCDEGH operon fragment comprising glycerol dehydratase and its activator (sequence such as shown in SEQ ID NO.3) and perform PCR product purification.
[0041] Using the genome of Escherichia coli MG1655 as a template, PCR was carried out with primers yqhD-F (ctatgacatgattacgaattAAGGAGATATACCatgAACAACTTTAATCTGCAC) and yqhD-R (ATATCTCTTttaGCGGGCGGCTTCG) as primers to obtain the alcohol dehydrogenase gene yqhD fragment (sequence shown in SEQ ID NO.4) and purify .
[0042] The Escherichia coli-Corynebacterium glutamicum shuttle plasmid pXMJ19 [disclosed in Jakoby, M.J., Ngouto-Nkil...
Embodiment 3
[0044] The fermentation culture of embodiment 3 recombinant Corynebacterium glutamicum
[0045] The wild strain of Corynebacterium glutamicum ATCC13032 and the recombinant strain C.glutamicum / pEC-hdpA-gldA obtained in Example 1, the recombinant strain C.glutamicum / pEC-hdpA-gldA / pXMJ-yqhD- pdu were cultured overnight on LB plates. Single bacterium colonies were inoculated from the fresh plate into a 250 ml shaker flask with baffles containing 30 ml of seed medium, and cultured at 32° C. at 200 rpm for 12 hours.
[0046] The formulation of the seed medium includes (g / L): Glucose 25, (NH 4 ) 2 SO 4 5.0,K 2 HPO 4 1.5, MgSO 4 1.0,MnSO 4 0.005,FeSO 4 0.005, corn steep liquor 30, kanamycin 0.025.
[0047] Inoculate the seed liquid into 2L fermentation medium with 10% inoculum amount, use a 5L fermenter for fermentation, control the temperature at 32°C, the ventilation rate at 1vvm, adjust the speed to keep the dissolved oxygen level above 10%, and feed Ammonia water co...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com