Glucose-6-phosphate dehydrogenase and malic enzyme coordinate-expressed recombinant mortierella alpine strain, constructing method thereof and application thereof
A technology of Mortierella alpine and glucose phosphate, applied in the field of bioengineering
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0064] Example 1: Bioinformatics analysis of Mortierella alpina ATCC32222 genome
[0065] According to the published genome information of Mortierella alpina ATCC32222 (DDBJ / EMBL / GenBankaccessionADAG00000000, firstversionADAG01000000), the protein coding sequence was predicted by BLAST to the protein database NR (www.ncbi.nlm.nih.gov), KOGs and COGs, KEGG, UniRef100 And Swiss-Prot, BRENDA search comparison. The protein structure database was compared using InterProScan software. It is predicted that the g6pd2 gene coding sequence encoding G6PD2 has a full length of 1545 bp, as shown in SEQ No.1.
Embodiment 2
[0066] Embodiment 2: Mortierella alpina total RNA extraction
[0067] (1) Take out an appropriate amount of Mortierella alpina ATCC32222 cells frozen in liquid nitrogen and fully grind them in a sterile, enzyme-free mortar.
[0068] (2) Add 1 mL of TRIzol (purchased from Invitrogen, California, USA) reagent, continue grinding, and place at room temperature until dissolved.
[0069] (3) Pipette 1 mL of the liquid from step (2) into an enzyme-free centrifuge tube, add 200 μL of chloroform and mix well.
[0070] (4) Aspirate the supernatant into a new enzyme-free centrifuge tube, and centrifuge at 12000×g, 4°C for 15 minutes.
[0071] (5) Add an equal volume of isopropanol, let stand for 15 minutes, and then centrifuge at 12,000 rpm and 4°C for 15 minutes.
[0072] ⑹Use an enzyme-free pipette tip to suck out the isopropanol in the mixture as much as possible.
[0073] (7) The obtained precipitate was washed once with 70% (volume ratio) ethanol, and then centrifuged at 12000×g ...
Embodiment 3
[0077] Embodiment 3: obtain g6pd2 gene and ME2 expression unit DNA fragment
[0078] (1) Take 1 μg of total RNA as a template, and operate according to the instructions of the PrimeScriptRTreagentkit (purchased from TaKaRa Company, Shiga Prefecture, Japan) to obtain the cDNA of Mortierella alpina.
[0079] (2) According to the results of genome bioinformatics analysis, primers were designed for the predicted g6pd2 gene and the instructions of In-FusionHD Cloning Kit (purchased from Clontech Laboratories, California, USA) as follows (restriction sites are underlined):
[0080] G6PD2F: GCACGG GGTACC ATGTCTGAGAAGAAGAAGCATCTTT
[0081] G6PD2R:GCTCCC CCCGGG TTAATGGTCAGTCCTTGTGTCCT
[0082] InFusF:
[0083] CTCTCCTATGAGTCGTTTACCCAGAATGCACAGGTACACTTGTTTAGAGGTCTAGATTTAGTTGATGTGAGAGTTGTGAGATTCGTG
[0084]InFusR:
[0085] AAACGACAATCTGATCATGAGCGGAGAATTAAGGGAGTCACGTTATGACCTCTAGACCTCTAAACAAGTGTACCTGTGCATTCTGGG
[0086] (3) Using cDNA and plasmid pBIG2-ura5s-malE2 (refer to publish...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap