Nucleic acid molecule, carrier and applications of nucleic acid molecule and carrier in improvement of sporulation ratio, sporulation quantity and anti-ultraviolet capability of metarhizium anisopliae

A nucleic acid molecule, Metarhizium anisopliae technology, applied in the introduction of foreign genetic material, application, fungi and other directions using a vector, can solve the problems of high production cost of fungal pesticides, reduced insecticidal efficiency, and unstable control effect, etc. The effect of enhanced UV resistance, prolonged survival time, and improved stability

Inactive Publication Date: 2015-12-23
夏玉先 +1
View PDF0 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the high production cost and unstable control effect of fungal insecticides greatly restrict their application.
The production cost of fungal insecticides is mainly affected by the sporulation time and sporulation quantity; the unstable control effect is mainly due to the adverse environment such as ultraviolet radiation and high temperature affecting the survival rate of fungal spores, thus reducing the insecticidal efficiency

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Nucleic acid molecule, carrier and applications of nucleic acid molecule and carrier in improvement of sporulation ratio, sporulation quantity and anti-ultraviolet capability of metarhizium anisopliae
  • Nucleic acid molecule, carrier and applications of nucleic acid molecule and carrier in improvement of sporulation ratio, sporulation quantity and anti-ultraviolet capability of metarhizium anisopliae
  • Nucleic acid molecule, carrier and applications of nucleic acid molecule and carrier in improvement of sporulation ratio, sporulation quantity and anti-ultraviolet capability of metarhizium anisopliae

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] Example 1 Knockout of the serine / threonine protease gene carrier and the acquisition of engineering strain ΔPP5

[0026] I, acquisition of metarhizium anisopliae serine / threonine protease gene

[0027] 1) Metarhizium anisopliae serine / threonine protease gene is shown in SEQ ID NO.1.

[0028] 2) Design the 3' extended fragment of the serine / threonine protease gene as Ser / Thr left arm (sequence such as SEQ ID NO.3) and the 5' extended fragment as Ser / Thr right arm (sequence such as SEQ ID NO.2).

[0029] 3) Design primers based on the obtained left and right arm sequences.

[0030] Left arm primer F:

[0031] CGACGGCCAGTGCCAAGCTT GTGCTGGTGTTGCCTTGTG

[0032] Left arm primer R:

[0033] ACCTGCAGCCCGGGGGATCC TGCGAGGCGGCGGCCGAAGGC

[0034] Right arm primer F:

[0035] CTGGCCGCCCATGGGATATC AACCACAAGATGAATAAGAT

[0036] Right arm primer R:

[0037] CTATGACATGATTACGAATTC CCACGTAGCCATCCAACCGCGC

[0038] The underlined part of the primer is the linker sequence

...

Embodiment 2

[0044] Example 2: Spore-producing ability of engineering strain ΔPP5

[0045] 1. Sporulation ability on 1 / 4SDA medium

[0046] The mature spores of the engineering strain ΔPP5, the wild-type strain and the reverted strain were prepared with paraffin oil to make 1×10 7 individual / mL of spore suspension. Take 2uL of the spore suspension and drop it on the 1 / 4SDA solid medium in the 24-well plate, then place the 24-well plate in an incubator at 28°C for cultivation, and take out the engineering strain ΔPP5, wild-type strain and reverted strain every three days Three Metarhizium anisopliae in the well were counted with a hemocytometer, and the sporulation of each strain was measured. The analysis of spore production compares as figure 1 As shown, the maximum sporulation of the knockout strain was 10.07×10 on the 9th day 7 piece / cm 2 , the wild strain is 4.63×10 7 piece / cm2 , the sporulation of the knockout strain was 2.2 times that of the wild type.

Embodiment 3

[0047] Example 3: Anti-ultraviolet ability of engineering strain ΔPP5

[0048] The mature spores of the engineering strain ΔPP5, the wild-type strain and the reverted strain were prepared with paraffin oil to make 1×10 7 individual / mL of spore suspension. Take 100uL of spore suspension and evenly spread it on the plate containing 1 / 4 SDA medium, then place the plate at 768mWm -2 UV-B environment was irradiated for 3, 6, 9 and 12 hours, and then the culture dish was placed in an incubator at 28°C for 24 hours. After the spores of Metarhizium anisopliae irradiated by ultraviolet were cultured for 24 hours, the germination rate was measured; at the same time, the nuclei of the spores irradiated by ultraviolet were stained with DAPI, and the damage of the nucleus was observed under a fluorescent microscope, and the fragmentation of DNA was quantified Analysis, the analysis and comparison results of UV resistance are as follows: figure 2 As shown, the half-lethal time of the wi...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention provides a nucleic acid molecule, which contains a 5'-end extension sheet and a 3'-end extension sheet of a metarhizium anisopliae threonine / serine protein phosphatase gene (Ser / Thr Phosphatase 5, PP5), wherein the 5'-end extension sheet is a Ser / Thr right arm in the upstream of the metarhizium anisopliae threonine / serine protein phosphatase gene; and the 3'-end extension sheet is a Ser / Thr left arm in the downstream of the metarhizium anisopliae threonine / serine protein phosphatase gene. The nucleic acid molecule can be used for preparing a metarhizium anisopliae threonine / serine protein phosphatase gene-deleted bacterial strain and improving the sporulation ratio, the sporulation quantity and the anti-ultraviolet capability of metarhizium anisopliae.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a nucleic acid molecule and a carrier, which can be used to improve the spore production speed, spore production amount and spore UV resistance of Metarhizium anisopliae. Background technique [0002] Gene knockout is a technology that integrates a foreign gene into a certain site on the genome of a target cell through homologous recombination, so as to achieve the purpose of site-directed modification and transformation of a gene on a chromosome. It overcomes the blindness and chance of random integration, and is an ideal method for modifying and transforming biological genetic material. The birth of this technology can be said to be another revolution in molecular biology technology after transgenic technology, which makes the operation of gene target sites more clear in time and space, and the effect is more precise and reliable. [0003] Fungi are the main pathogenic microorgani...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N15/11C12N15/80C12N1/15A01N63/04A01P7/04
Inventor 夏玉先张杰王正龙彭国雄
Owner 夏玉先
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap