Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Nested PCR (polymerase chain reaction) kit for detecting chicken-manure pollution in water body and detection method thereof

A kit and water body technology are applied in the field of nested PCR kits for detecting chicken manure contamination in fecal-contaminated water bodies, which can solve the problem that the method for detecting fecal contamination cannot be traced to the source, and achieve good specificity, reduce misjudgment, and high sensitivity. Effect

Active Publication Date: 2015-09-02
NANJING UNIV
View PDF0 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] Aiming at the technical problem that the traditional method for detecting fecal pollution cannot be traced back, the present invention provides a nested PCR detection method and kit for detecting chicken manure pollution in water bodies, which can quickly and accurately detect trace chicken manure pollution in water bodies

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Nested PCR (polymerase chain reaction) kit for detecting chicken-manure pollution in water body and detection method thereof
  • Nested PCR (polymerase chain reaction) kit for detecting chicken-manure pollution in water body and detection method thereof
  • Nested PCR (polymerase chain reaction) kit for detecting chicken-manure pollution in water body and detection method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036]A nested PCR kit for detecting chicken manure pollution in water bodies, including two pairs of nested PCR primers, dNTP, PCR buffer, Taq enzyme, Mg 2+ and ddH 2 O, two pairs of nested PCR primers are:

[0037] SCF: 5’‐CACATGTTATCTGCACCAGC‐3’

[0038] SCR: 5’‐GTTAAGGGTACGAGTTTGTCG‐3’

[0039] NCF:5’‐CCAAATCCATCTTAGCCTCAAC‐3’

[0040] NCR: 5'-GGCGGGTTTCACATCCTT-3'.

[0041] The above two pairs of nested PCR primers were custom-synthesized by Sangon Bioengineering (Shanghai) Co., Ltd.

[0042] ddH above 2 O is sterile double distilled water. The concentration of Taq enzyme is 5U / ul. Mg 2+ The concentration of the solution is 25mmol / L, which is MgCl 2 solution. The concentration of dNTPs was 2.5 mmol / L. PCR buffer is 10×PCR buffer (purchased from Takara, Code No.RR001A)

[0043] Collect fresh feces of chicken, human, pig, cow, sheep, duck, goose, and mouse, extract DNA from 0.2 grams of feces, and use it as a template for the first round of PCR amplification. Th...

Embodiment 2

[0048] Take 0.2 grams of chicken manure to extract DNA, and the measured DNA concentration is 35.0ng / ul. The DNA solution is serially diluted by the four-fold dilution method, and the dilution ratios obtained are 1 / 4 and 1 / 4 respectively. 2 , 1 / 4 3 , 1 / 4 4 , 1 / 4 5 , 1 / 4 6 , 1 / 4 7 Chicken manure DNA solution, each concentration of DNA solution was used as a template for the first round of PCR amplification, the reaction system was 2.5ul of 10×PCR buffer; 2.5ul of dNTP; 0.1ul of Taq enzyme; 2ul of 25mmol / L Mg 2+ Solution; 0.5ul concentration of 10umol / L upstream and downstream primers SCF, SCR; 2ul template DNA; sterilized ddH 2 Make up to 25ul with O; the reaction conditions are 95°C, pre-denaturation for 5min; 40 cycles of 95°C for 30s, 58°C for 30s, 72°C for 45s; 72°C for 7min, and storage at 4°C.

[0049] Perform 1% agarose gel electrophoresis on the first round of PCR products, the electrophoresis conditions are: voltage 120V, current 440mA, time 25min, the electrophor...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a nested PCR (polymerase chain reaction) kit for detecting chicken-manure pollution in a water body and a detection method thereof, and belongs to the field of the detection of pollution in water bodies. The nested PCR kit for detecting the chicken-manure pollution in the water body comprises two pairs of nested PCR primers, dNTP (deoxyribonucleoside triphosphate), a PCR buffer, a Taq polymerase, a Mg<2+> solution and ddH2O (double distilled water). Two rounds of PCR amplification are used by a nested PCR method. The detection method comprises the following steps of extracting a DNA (deoxyribonucleic acid) in a water sample, and carrying out a first round of PCR amplification by using the DNA in the water sample as a template, wherein the primers are an SCF (stem cell factor) and SCR (serum creatinine); after a reaction is terminated, carrying out a second round of PCR amplification by using a product of the first round of PCR amplification as a template, wherein the primers are an NCF (neutrophil chemotactic factor) and NCR (nitrile chloroprene rubber), and after the second round of PCR amplification is terminated, detecting the existence of a 403bp strip, which shows that the water body is subjected to the chicken-manure pollution, through agarose gel electrophoresis. According to the method, the detection sensitivity is greatly increased through the nested PCR amplification; a little chicken-manure pollution which exists in water can be detected; moreover, the method has a favorable specificity, and can be directly applied to the detection and the preventive treatment work of fecal pollution in the water body.

Description

technical field [0001] The invention relates to the field of water pollution detection, in particular to a nested PCR kit for detecting chicken manure pollution in feces-polluted water and a detection method thereof. Background technique [0002] In recent years, my country's water pollution has become increasingly serious, threatening people's living environment and healthy water use, and causing serious economic losses to the society. The livestock and poultry breeding industry in the Taihu Lake Basin is well developed, and the aquaculture wastewater is one of the main sources of water pollution in the Taihu Lake Basin. When fecal pollutants enter the water body, it will not only increase the nitrogen and phosphorus content of the water body, causing eutrophication, but also bring in the pathogenic bacteria that may exist in the feces, causing the water transmission of diseases (Baldursson, S. and Karanis, P. (2011) Waterborne transmission of protozoan parasites: Review o...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68
CPCC12Q1/6848C12Q2531/113C12Q2549/119C12Q2565/125
Inventor 陈慧梅何席伟张徐祥于红霞史薇
Owner NANJING UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com