Haynaldia villosa disulfide isomerase gene and application thereof
A disulfide and isomerase technology, applied in the field of genetic engineering, can solve the problems of increasing manpower, material resources, environmental pollution, etc., and achieve the effect of improving resistance
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0033] Example 1 Using yeast two-hybrid to clone the disulfide isomerase gene Hv-PDI
[0034] Diploid pilosetris (references: Qi Lili, Chen Peidu, et al., New source of resistance to wheat powdery mildew—gene Pm21, Acta Crops Sinica, 1995, 21(3):257-262) is a material highly resistant to powdery mildew. Hv-CMPG is a powdery mildew resistance-related gene located on diploid P. villosa 6V cloned by the Institute of Cytogenetics, Nanjing Agricultural University (Liu Yuan. Cloning of Hv-CMPG gene in P. villosa and preliminary analysis of its function[D] .Nanjing.Nanjing Agricultural University, 2007), with Hv-CMPG as bait, use polyethylene glycol-lithium acetate transformation method to screen yeast two-hybrid cDNA library, get a Hv-CMPG interaction gene (attached figure 1 ). The interacting gene was sequenced, and a sequence with a size of 1615 bp was obtained, as shown in SEQ ID NO.1. Search the open reading frame of the obtained sequence through the ORF finder on the NCBI web...
Embodiment 2
[0035] Embodiment 2Hv-PDI gene is subjected to the expression characteristic that powdery mildew induces
[0036] Sowing the wheat seeds resistant to powdery mildew (references: Qi Lili, Chen Peidu, etc., new resistance source of wheat powdery mildew-gene Pm21, Acta Biological Sciences, 1995, 21(3): 257-262) in a petri dish to germinate , and transplanted to pots after dew whitening (isolated with a cylindrical transparent plastic sheet around, and closed with filter paper at the top to form an environment free of powdery mildew). At the three-leaf stage, shake off the fresh spores of Nanjing local mixed powdery mildew cultured on the susceptible variety Sumai No. 3 on the seedlings of A. The leaves of T. villosa inoculated with powdery mildew were stored at 16°C. Samples were taken at 0h, 30min, 45min, 1h, 2h, 6h, 12h, 24h, 48h, and 72h after inoculation, and stored in a -70°C refrigerator for later use. TRIZOL (Invitrogen) was used to extract RNA from the leaves of A. vill...
Embodiment 3
[0038] Example 3 Hv-PDI sense expression vector construction
[0039]Using the above-mentioned C. villosa cDNA induced by powdery mildew as a template, the primer pair P3 (CGGGATCCATGCGTCCGGCCATCC (SEQ ID NO.5)) and P4 (GGGGTACCTCACAACTCGTCGTTGGGC (SEQ ID NO.6) that can amplify the protein coding region of the Hv-PDI gene )) PCR amplification was carried out, and the amplified fragment with a size of 1323bp was recovered. The amplified fragment was inserted into pMD18-T (Takara), sequenced and compared with the original sequence, it was Hv-PDI gene, and the amplified target fragment was inserted into the vector pBI220 (Jefferson RA, Kavanagh TA) with BamHI and Kpnl double enzyme digestion , Bevan MW. GUS fusions: beta-glucuronidase as a sensitive and versatile gene fusion marker in higher plants. EMBO J.1987, 6: 3901-3907.) Between the multiple cloning sites BamHI and Kpnl behind the 35S promoter. Thus, the target gene Hv-PDI was cloned to the downstream of the strong promote...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap