Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Chicken Eimeria tenella actin depolymerizing factor (ADF) recombinant bacillus calmette-guerin and preparation method thereof

A technology for recombining BCG and chicken coccidia, which is applied in the field of genetic engineering, can solve the problem that there is no ideal vaccine for chicken coccidia, and achieve strong immune protection, cost reduction, and good stability

Inactive Publication Date: 2013-09-18
JILIN UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] The present invention provides a kind of chicken coccidia ADF recombinant BCG, which is two kinds of novel live carrier vaccines against Eimeria tenella, which solves the current problem of chicken coccidia The Problem With No Ideal Vaccine

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Chicken Eimeria tenella actin depolymerizing factor (ADF) recombinant bacillus calmette-guerin and preparation method thereof
  • Chicken Eimeria tenella actin depolymerizing factor (ADF) recombinant bacillus calmette-guerin and preparation method thereof
  • Chicken Eimeria tenella actin depolymerizing factor (ADF) recombinant bacillus calmette-guerin and preparation method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Preparation of coccidia recombinant BCG vaccine of the present invention

[0035] The present invention takes coccidia invasion-related gene ADF gene as an example to construct a shuttle expression vector and an integrated expression vector.

[0036] one, The preparation steps of the shuttle expression vector coccidian recombinant BCG vaccine:

[0037] Two pairs of specific primers were designed with reference to the DNA sequence of the ADF gene and the physical map of the shuttle expression vector pMV261, and restriction sites were introduced.

[0038] Upstream primer AD1: 5 AGCTGCAG ATG GCG AGC GGA ATG CCA GTC 3; the 5' end contains a PstI site;

[0039] Downstream primer AD: 5 GAATCGAT CTAATGGAGCACGCTTAGGTC 3; 5' end contains ClaI site.

[0040] Using cDNA as a template, the ADF gene was amplified by RT-PCR technology, and the amplified product was connected to the PMD18-T cloning vector, followed by PCR, enzyme digestion and sequencing identification, and...

Embodiment 2

[0047] The purposes of coccidia recombinant BCG vaccine of the present invention

[0048] 1. Application of Shuttle Expression Vector Coccidia Recombinant BCG Vaccine

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention provides chicken Eimeria tenella actin depolymerizing factor (ADF) recombinant bacillus calmette-guerin and a preparation method thereof. The preparation method comprises obtaining Eimeria tenella oocyst, extracting ribose nucleic acid (RNA), reversely transcribing the RNA into complementary deoxyribose nucleic acid (cDNA), designing primers according to an open reading frame of a cloned Eimeria tenella ADF gene sequence to perform polymerase chain reaction (PCR), enabling amplification products obtained by amplifying ADF genes to be connected with a PMD-18 vector to perform clone, performing enzyme digestion on a plasmid with correct sequencing identification, recycling a target fragment, enabling the plasmid to be respectively connected with an escherichia coli-mycobacterium shuttle expression vector PMV 261 and an integrated expression vector PMV 361 which use the same enzyme to perform enzyme reaction, and then obtaining the positive chicken Eimeria tenella recombinant bacillus calmette-guerin through resistance screening and PCR identification. The live vector vaccine is good in stability, easy to transport, store and produce, free of purification, capable of being directly used for immune protection tests, removing complex processes of post-processing of proteins and greatly reducing cost, and suitable for vast rural areas.

Description

technical field [0001] The invention provides a chicken coccidia ADF recombinant BCG, and also provides a preparation method of the vaccine, which belongs to the technical field of genetic engineering. Background technique [0002] Chicken coccidiosis is caused by a single-cell parasitic protozoan of the genus Eimeria, a global protozoan disease, and one of the important diseases that seriously endanger the chicken industry, among which Eimeria tenella ( E. tenella ) are the most serious. E. tenella It mainly parasitizes the cecal epithelial cells of chickens. The schizonts multiplied in large numbers in the epithelial cells of the cecum, severely damaged the intestinal mucosa, swollen and hemorrhaged the cecum, and the sick chickens were obviously emaciated, anorexia, developmental stagnation and even death. The disease is widely distributed, and it has been mainly controlled by drugs and live coccidian vaccines for a long time. However, in recent years, due to the emerg...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): A61K39/012C12N15/66A61P33/02
Inventor 张西臣李建华李运娜宫鹏涛程柏淇张国才杨举李赫陈玉江任文陟
Owner JILIN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com