Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Target glioma resistant protein, preparation method and application

A glioma and protein technology, applied in botany equipment and methods, biochemical equipment and methods, anti-tumor drugs, etc., can solve the problem of limited anti-glioma drug research and development, low protein expression, late stage Purification is difficult and other problems, to achieve the effect of inhibiting malignant proliferation and metastasis, the effect is remarkable, and it is not easy to deteriorate

Inactive Publication Date: 2010-12-22
WUHAN UNIV
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Therefore, the content of chlorotoxin in scorpion venom is very low, and the yield and cost of isolating and purifying chlorotoxin from scorpion venom mixture are low and expensive, which severely limits the research and development of scorpion chlorotoxin anti-glioma drugs
Although a large amount of protein can be produced by using genetic engineering technology, scorpion chlorotoxin is only composed of dozens of amino acids (less than 40aa), which is a very small protein polypeptide. If genetic engineering is used to produce recombinant scorpion chlorotoxin, Then chlorotoxin is easily degraded by protease in the receptor expressing bacteria, and the expression level of such a small protein is not high and it is difficult to purify later

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Target glioma resistant protein, preparation method and application
  • Target glioma resistant protein, preparation method and application
  • Target glioma resistant protein, preparation method and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Example 1: Molecular design of W2 gene

[0035] Based on the reported amino acid sequence of scorpion chlorotoxin BmKCT (AF135821), the nucleotide sequence encoding the protein was deduced using conventional methods, while considering the codon bias of Escherichia coli. On this basis, primers were designed for PCR amplification to obtain the target gene W2. Forward primer P1: 5'GCGGATCCGTGCGGTCCGTGCTTCACCACC 3', primer P2: 5'GCAGCATTCACGGCATTTACGAGCCATGTTAGCGTCGGTGGTGAAGCA'; reverse primer P3: 5'TGCCGTGAATGCTGCGGTGGTATCGGTAAATGCTTCGGTCCGCCTTCAACGGC 3', primer P4: 5'CCCAAGGACTCAACGGCC. Primer P2 and primer P3 are used for the first round of PCR amplification, and primer P1 and primer P4 are used for the second round of PCR amplification. The reagents for the first round of PCR reaction are as follows: mix 5 μl of 10xTaq polymerase buffer, 4 μl of dNTP mix, 1 μl of primer P2, 1 μl of primer P3, 0.25 μl of Taq DNA polymerase and 37.75 Mix in microliters of sterile water....

Embodiment 2

[0036] Embodiment 2: Construction of Acp-W2 protein recombinant expression vector

[0037] A: Double digestion and ligation of W2 and pGEX-6p-1

[0038] The PCR product obtained in Example 1 was extracted with phenol:chloroform:isoamyl alcohol (25:24:1), precipitated with absolute ethanol (2.5 volumes), and then dissolved with 50 μl of sterilized water. The recovered PCR product and expression vector pGEX-6p-1 plasmid were digested with restriction endonucleases BamHI and HindIII (products of Takara Company). Enzyme digestion reaction: BamHI (14U / μl) and HindIII (20U / μl) 1μl each, 10 times buffer 2.5μl, PCR product or pGEX-6p-1 plasmid 50-100ng, add sterile water to a total volume of 25μl . Water bath at 37°C for 5 hours, the digested product was extracted with phenol: chloroform: isoamyl alcohol, precipitated with absolute ethanol (2.5 volumes) and washed with T 4 The PCR product was ligated with the expression vector pGEX-6p-1 with DNA ligase (product of Takara Company). ...

Embodiment 3

[0045] Embodiment 3: the preparation of recombinant Acp-W2 genetically engineered bacteria

[0046] The positive clones sequenced correctly in step 2C of Example 2 were extracted by alkaline lysis method to extract the recombinant expression plasmid pGEX-Acp-W2 (see the second edition of "Molecular Cloning" for the method). The extracted pGEX-Acp-W2 plasmid was transformed into Escherichia coli competent Rossetta (DE3) cells prepared in the step of Example 2B according to the transformation method in the step of Example 2C. Tablet for LB / AP + Agar plates. Single clones were picked to obtain the genetically engineered strain Rossetta (DE3) (pGEX-Acp-W2).

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
purityaaaaaaaaaa
Login to View More

Abstract

The present invention discloses a targeting anti-glioma protein, a preparation method and applications. The present invention separates out a protein, the sequence of which is an amino acid sequence shown as SEQ ID No: 1. Primers related to genetic engineering insert the nucleotide sequence of chlorotoxin into an expression vector pGEX-6p-1, so that a recombinant expression plasmid is formed; therecombinant expression plasmid transforms colon bacillus Rossetta (DE3), and after cell lysis, the Acp-W2 protein is produced by affinity chromatography, ultrafiltration, desalination and chromatography purification. The Acp-W2 protein has specific targeting effect on gliomas, can effectively inhibit the proliferation of rat gliomas and has targeting anti-glioma effect. The Acp-W2 protein is applicable to the preparation of drugs treating or preventing gliomas. The preparation method of the present invention has the advantages of simplicity, convenient operation, high output and good biological activity.

Description

technical field [0001] The invention belongs to the field of biotechnology, and the invention relates to a targeting anti-glioma protein (Acp-W2), and also relates to a preparation method of the targeting anti-glioma protein (Acp-W2), and also relates to genetic engineering The use of protein Acp-W2, the targeted anti-glioma protein produced by genetic engineering can efficiently inhibit the proliferation and metastasis of glioma at the animal model level, and has the application value of being developed into an anti-glioma drug. Background technique [0002] Brain glioma is the most common tumor of the central nervous system, its incidence rate accounts for about 40% of all intracranial tumors, and the average survival time of patients is one year. The efficacy and application potential of all current treatment measures (such as: surgical resection, chemotherapy, radiotherapy and immunotherapy, etc.) are extremely limited. In view of this grim situation, there is an urgent...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C07K14/435C12N15/12C12N15/70A61K38/17A61P35/00
Inventor 李文鑫曹志贱蒋达和范少忠孙正博吴英亮
Owner WUHAN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com