Photosynthetic microorganism as well as application and plasmid thereof
A technology of photosynthetic microorganisms and plasmids, applied in the biological field, can solve the problems of high production costs and achieve the effect of reducing the cost of substrates
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0045] Construction of expression plasmid pSyn- pct - phaC - ldh :
[0046] (1) Extract the pSyn_6 plasmid:
[0047] Escherichia coli DH5α containing the pSyn_6 plasmid was inoculated into 5 mL of LB liquid medium containing 100 mg / l spectinomycin according to 2% inoculum, at 37 ° C incubator for 12 h. The cultured cells were extracted with a common plasmid extraction kit (Tiangen Biochemical Technology Co., Ltd.) according to the method described in the manual.
[0048] (2) Synthesis of propionyl-CoA transferase gene ( pct ) fragment, polyhydroxyalkanoate synthase gene ( phaC ) fragment and the d-lactate dehydrogenase gene ( ldh ) fragment:
[0049] Using the online software JCat, Clostridium propionicum ( Clostridium propionicum ) encoding genes for PCT pct Perform codon optimization, after optimization pct The nucleotide sequence of Pseudomonas is shown in SEQ ID NO: 1; Pseudomonas ( Pseudomonas sp.) encoding gene for PhaC phaC Perform codon optimiza...
Embodiment 2
[0063] Construction of expression plasmid pSyn- pct - phaC - ldh - pdhA - acs :
[0064] (1) Amplification of the pyruvate dehydrogenase gene ( pdhA ) fragment and the acetyl-CoA synthase gene ( acs ) fragment:
[0065]The genomic DNA of Synechococcus PCC7942 was prepared by a conventional method. For this process, please refer to the micro-preparation method of bacterial genome in "Guide to Molecular Biology" published by Science Press;
[0066] Using the Synechococcus PCC7942 genome as a template, PCR amplification was performed according to the method described in the "Experimental Guide for Molecular Cloning (Third Edition)".
[0067] PCR primers: pdhA Gene upstream primer pdhA -F: 5'-gagcgtcagatctcatatggttcaggaacgtacactgc-3', downstream primer pdhA -R:5'-cattctagattctcctctttaatttagtcttctgcccagatgtagc-3'; acs Gene upstream primer acs -F: 5′-taaattaaagaggagaatctagaatgagccagccaacgatcg-3′, downstream primer acs -R: 5'-gggtttgcctggtaccgcggttaagtgccttg...
Embodiment 3
[0078] Construction of expression plasmid pSyn- pct - phaC - ldh - phaAB and pSyn- pct - phaC - ldh - phaAB - pdhA - acs :
[0079] (1) Synthesis of acetoacetyl-CoA reductase gene and β-ketothiolase gene fragments ( phaAB ):
[0080] Using the online software JCat, according to the codon preference of Synechococcus PCC7942, the hookworm copper greedy bacteria ( Cupriavidus necator ) encoding gene for PhaB phaB Perform codon optimization, after optimization phaB The nucleotide sequence is shown in SEQ ID NO: 6; Cupriavidus necator )middle phaA the coding gene phaA Perform codon optimization, after optimization phaA The nucleotide sequence is shown in SEQ ID NO:7. Will phaA and phaB 序列相连,并在前端加上psbA2序列5′-ttaaggttggctaaaagcttggctggctatttagcgtcttctaatccagtgtagacagtagttttggctccgttgagcactgtagccttgggcgatcgctctaaacattacataaattcacaaaagttttcgttacataaaaatagtgtctacttagctaaaaattaagggttttttacacctttttgacagttaatctcctagcctaaaaagcaagagtttttaactaagactcttgccc...
PUM
Property | Measurement | Unit |
---|---|---|
molecular weight | aaaaa | aaaaa |
molecular weight | aaaaa | aaaaa |
molecular weight | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com