Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

White spot disease virus single-chain variable region recombinant antibody as well as preparation method and application thereof

A recombinant antibody and variable region technology, applied in the fields of botanical equipment and methods, biochemical equipment and methods, antibodies, etc., can solve the problems of long time-consuming preparation of monoclonal antibodies, high cost of mass production, and poor tissue permeability, etc. Achieve fast and efficient immunogenicity, prevent infection and spread, and have strong tissue penetration

Pending Publication Date: 2022-07-05
OCEAN UNIV OF CHINA
View PDF1 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the preparation of monoclonal antibodies to VP28 takes a long time, the purification process is difficult, and the cost of mass production is high; and because of its large molecular weight and high immunogenicity, it has poor tissue permeability and is easily degraded in clinical treatment applications; Monoclonal antibodies cannot be designed and operated through genetic engineering, which affects their large-scale application and promotion

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • White spot disease virus single-chain variable region recombinant antibody as well as preparation method and application thereof
  • White spot disease virus single-chain variable region recombinant antibody as well as preparation method and application thereof
  • White spot disease virus single-chain variable region recombinant antibody as well as preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] Example 1: Preparation of recombinant protein of vitiligo virus envelope protein VP28 and development of neutralizing monoclonal antibody

[0037] 1. Preparation of VP28 recombinant protein of vitiligo virus envelope protein

[0038] (1) Based on the published WSSV genome sequence, a specific primer pair for VP28 was designed and used to amplify its open reading frame (ORF). All primers used for recombinant expression are listed in Table 1.

[0039] rVP28-F CGGGATCCATGGATCTTTCTTTCACTCTTTCGGTCG rVP28-R CCCAAGCTTCTCGGTCTCAGTGCCAGAGTAGGTG

[0040] (2) The amplified sequence was ligated into pET-32a vector and transferred into E. coli BL21 (DE3). Positive clones were screened by PCR and their correctness was confirmed by sequencing. Positive E. coli BL21 was grown in LB medium at 37°C to exponential growth phase, and then 100 mM IPTG was added to induce the expression of recombinant VP28.

[0041] (3) The His-tagged VP28 recombination was purified...

Embodiment 2

[0073] Example 2: Single-chain variable region antibody gene cloning of the VP28-neutralizing monoclonal antibody 3B7 of vitiligo virus

[0074] 1. Recovery of hybridoma cell lines, extraction of total RNA and synthesis of cDNA template

[0075](1) Take the cryopreserved anti-WSSV-VP28 neutralizing monoclonal antibody 3B7 hybridoma cell line out of the -80°C refrigerator, and immediately place it in a pre-heated 37°C water bath to thaw until it is completely thawed, and 1000 Centrifuge at room temperature for 3 minutes at rpm, carefully pour off the supernatant in the ultra-clean workbench, add 1ml of pre-warmed GIT cell culture medium at 37°C to gently suspend the cells, transfer to a 24-well cell culture plate, set with 4.5% CO 2 Cultured in a cell incubator.

[0076] (2) Take the cells in the logarithmic growth phase for total RNA extraction. The cells in the logarithmic growth phase are transparent, regular in shape, round and translucent. Collect about 1×l0 7 The hybri...

Embodiment 3

[0109] Example 3: Recombinant expression of single-chain variable region antibody of the present invention

[0110] (1) Use primer scFv-3B7V H F and scFv-3B7V L R to carry out the amplification of the scFv-3B7 gene, and the PCR product recovery kit to recover the target gene for use.

[0111] (2) Take the DNA fragment obtained in the previous step and the pET28a vector for double-enzyme digestion experiments.

[0112] (3) Configure the T4 DNAligase ligase system according to the molar ratio of the vector to the target gene of 1:10 (0.03pmol:0.3pmol), and react at 16°C overnight.

[0113] (4) All ligation systems were added to DH5α competent cells, and the transformation operation was carried out. The positive clones were screened by colony PCR and sent to the company for sequencing.

[0114] (5) Pick the correctly sequenced strains on the plate, culture them in liquid LB medium containing kanamycin overnight, extract the plasmids, and transform them into BL21 (DE3) competen...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
diameteraaaaaaaaaa
Login to View More

Abstract

The invention discloses a white spot disease virus single-chain variable region recombinant antibody as well as a preparation method and application thereof. A strain WSSV-VP28-3B7-scFv for efficiently expressing the protein is prepared by cloning an scFv gene sequence of the anti-WSSV-VP28 neutralizing monoclonal antibody 3B7, so that the single-chain variable region recombinant antibody of the WSSV-VP28 neutralizing monoclonal antibody is obtained. The recombinant single-chain variable region antibody can be specifically combined with and recognize natural protein of the envelope protein VP28 of the white spot disease virus, also can recognize white spot disease virions, and can effectively neutralize the white spot disease virus and delay prawn death caused by the virus. The prepared single-chain variable region antibody of the white spot disease virus envelope protein VP28 neutralizing monoclonal antibody provides an important tool for research on rapid detection, diagnosis and prevention of white spot disease viruses based on the single-chain variable region antibody.

Description

technical field [0001] The invention relates to a single-chain variable region recombinant antibody, a preparation method and application thereof, in particular to a white spot virus single-chain variable region recombinant antibody, a preparation method and application thereof, and belongs to the technical field of shrimp molecular immunology. Background technique [0002] White spot syndrome virus (WSSV) is a worldwide epidemic that can infect a variety of marine and freshwater aquaculture shrimp and crabs, causing white spot syndrome. WSSV belongs to the genus Nimaviridae (Nimaviridae) Whispovirus ), is a double-stranded DNA virus with an envelope, the virion is oval, oval or rod-shaped, regularly symmetrical, 80-120nm in diameter and 250-380nm in length. The genome size of WSSV is about 300Kbp and encodes at least 181 polypeptides. A variety of structural proteins and about 30 envelope proteins have been found in WSSV. As one of the important envelope proteins of WSSV,...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K16/08C12N15/70C12N15/34C12N1/21C12P21/08G01N33/569G01N33/577A61K39/395A61P31/20C12R1/19
CPCC07K16/081C12N15/70C07K14/005G01N33/56983G01N33/577A61P31/20C07K2317/76C07K2317/56C07K2317/565C12N2710/18022G01N2333/01G01N2469/10A61K2039/505Y02A50/30
Inventor 唐小千崔闯战文斌邢婧绳秀珍迟恒
Owner OCEAN UNIV OF CHINA
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com