Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

HBV BCP region 1762/1764 mutation digital PCR detection kit and use method thereof

A detection kit, G1764A technology, applied in DNA/RNA fragments, microorganism-based methods, biochemical equipment and methods, etc., can solve the problems of cumbersome operation, false negative, poor discrimination of single nucleic acid mutation, etc., to improve accuracy , easy to operate, reproducible and specific results

Pending Publication Date: 2022-04-01
WUHAN BIOTECH GENE ENG +1
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Among them, because the mutations in the BCP region are mainly point mutations, although fluorescent PCR detection has high sensitivity, it is poor in distinguishing single nucleic acid mutations, and cannot distinguish wild-type and mutant types well, which is likely to cause false negatives
The sequencing method has the advantages of high accuracy and the ability to distinguish specific mutant types, but its operation is extremely cumbersome. One sequencing includes multiple PCR, purification and other operations, which often takes more than 1 day and requires high technical requirements for experimenters. The invention aims to develop a digital PCR technology for BCP region mutation detection, through ARMS-PCR primer design technology and locked nucleic acid technology, improve the accuracy of mutation detection, and at the same time, it is easier to operate than the sequencing method

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • HBV BCP region 1762/1764 mutation digital PCR detection kit and use method thereof
  • HBV BCP region 1762/1764 mutation digital PCR detection kit and use method thereof
  • HBV BCP region 1762/1764 mutation digital PCR detection kit and use method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] Example 1 HBV BCP region 1762 / 1764 mutation digital PCR detection kit

[0039] The HBV BCP region 1762 / 1764 mutation digital PCR detection kit of the present invention includes primers and probes for detecting two mutation sites of BCP region A1762T and G1764A.

[0040] The sequences of primers and probes for detecting the A1762T mutation site are shown in SEQ ID NO: 1-3; the sequences of primers and probes for detecting the G1764A mutation site are shown in SEQ ID NO: 4-6.

[0041] A1762T point mutation:

[0042] Upstream primer: 5'-CTGGGGGAGGAGATtAGGTt T A -3', as shown in SEQ ID NO:1;

[0043] Downstream primer: 5'-GAGATGACTAGGCAgAGGTgAAA-3', as shown in SEQ ID NO:2;

[0044] Probe: 5'-FAM-TTGCATGGTGCTGGTGAACAGACCAATT-BHQ1-3', as shown in SEQ ID NO:3;

[0045] Amplified product: CTGGGGGAGGAGATTAGGTT A A GGTCTTTGTACTAGGAGGCTGTAGGCATAAATTGGTCTGTTCACCAGCACCATGCAACTTTTTTCACCTCTGCCTAGTCATCTC, as shown in SEQ ID NO:13.

[0046] G1764A point mutation:

[0047] Upst...

Embodiment 2

[0069] Example 2 HBV BCP region 1762 / 1764 mutation digital PCR detection kit using method

[0070] The method of using the HBV BCP region 1762 / 1764 mutation digital PCR detection kit includes the following steps:

[0071] S1, 1762 / 1764 mutant HBV was diluted to 1000 copies / μL and 20 copies / μL with negative serum, wild-type HBV was diluted to 1000 copies / μL, the above three virus-containing sera plus negative serum were extracted with a commercial kit, and Perform digital PCR detection, 10 times for each detection, and evaluate the repeatability and accuracy of the detection method.

[0072] S2, prepare a single reaction system according to the components and concentrations of the PCR reaction solution in Table 1.

[0073] S3, sample addition: mix 15 μL reaction solution + 5 μL sample for each reaction tube and add sample.

[0074] S4, preparation of microdroplets: add 8 20 μL reaction systems to 8 wells in the middle row of DG8 cartridge. Add 70 μl of droplet generating oil...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a digital PCR (Polymerase Chain Reaction) detection kit for 1762 / 1764 mutation in an HBV (Hepatitis B Virus) BCP (Bovine Colored Protein) region and a use method of the digital PCR detection kit. The kit comprises a primer and a probe for detecting two mutation sites A1762T and G1764A, an HBV wild type primer and a probe, an internal reference primer and a probe, a PCR reaction mixed solution, a positive control and a negative control. Locked nucleic acid is added from the 15th basic group and the 20th basic group at the 5'end of the primer for detecting the two mutation sites A1762T and G1764A for modification. The upstream primer for detecting the A1762T mutation site is provided with a base mismatch from the 21st site of the 5'end; and a downstream primer for detecting the G1764A mutation site is respectively provided with a base mismatch from the 20th site and the 22th site at the 5'end. Through an ARMS-PCR primer design technology and a locked nucleic acid technology, the accuracy of mutation detection is improved, and the kit has high sensitivity and specificity and is simpler and more convenient to operate compared with a sequencing method.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a digital PCR detection kit for HBV BCP region 1762 / 1764 mutation and a use method thereof. Background technique [0002] Hepatitis B (HBV) is one of the viral infectious diseases that seriously threaten the health of our people. During the continuous infection of HBV, its genomic DNA may undergo various mutations, and its mutation rate is much higher than that of other DNA viruses. The core promoter (BCP) region is an important component of mRNA transcription in the pre-C region of HBV. Mutations in the BCP region have great significance in virus replication, expression and pathogenicity. Mutations in the BCP region include T1753A / C, A1762T, G1764A, etc., among which the 1762-1764 double mutation is the most common. Compared with wild strains, mutant strains in the BCP region are more pathogenic due to the increased level of virus replication and escape from the body's immune surve...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/70C12Q1/686C12N15/11C12R1/93
Inventor 熊慧高峰英肖樊
Owner WUHAN BIOTECH GENE ENG
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com